Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.1819 Type I restriction-modification system, specificity subunit S (EC 3.1.21.3) [Staphylococcus aureus subsp. aureus COL]
atgagtaatacacaaaagaaaaatgtgccagaattgagattcccaggatttgaaggcgaa
tgggaagagaagaagttagggaatcttactaccaaaataggtagtggaaagactcccaaa
ggtggaagtgaaaactatacaaacaaaggcataccatttttaaggagtcaaaatattaga
aatggtaaattaaatcttaatgacttagtttatattagtaaagatatagatgatgagatg
aaaaatagtagaacgtactatggtgatgttcttttaaatattacaggagcatcaataggt
agaacagccattaattcgatagttgaaacgcatgctaatttaaatcaacatgtatgtatt
attagattgaaaaaagagtattattataatttttttggacagtatctattatcaagaaaa
ggtaaaaggaaaattttccttgcacaaagtggaggtagtcgagaaggtctaaacttcaaa
gaaattgctaatttaaaaatcttcaccccaactatatttgaagaacagcaaaaaataggc
aagttcttcagcaaactcgaccgacaaattgaattagaagaacaaaaacttgaattgctt
caacaacagaaaaaaggctatatgcagaaaatcttcacacaagaattgcgattcaaagat
gagaatggtgaagaatatccagagtgggaaaacaaattcataaaagacatctttatcttt
gaaaataatagaagaaaaccaattacttcttcattaagagaaaaggggttatacccttac
tatggtgcaactggaattattgattacgtaaaagattatttattcaataatgaagaacga
ttactaataggagaagatggtgcaaaatgggggcagtttgagacgagtagctttattgct
aatgggcaatactgggtaaataatcatgcgcatgtagttaaaagtaatgatcataatttg
ttttttatgaattattatttaaattttaaagaactacgagcatttgtcacaggtaatgca
ccagctaaattaactcatgcgaacttatgcaatataaatcttaaaataccttgtctcact
gaacaagataaagtaagtgcattgttaaaatctatagacaataaaatgaataatcaaatg
aatagaattgagttattaaaagaacgtaaaaaaggactattacaaaaaatgtttatttaa