Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.1235 Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5) [Staphylococcus aureus subsp. aureus COL]
atgagtgtatttatagataagaatactaaagtaatggtacaaggtattacagggtctact
gcccttttccatacaaaacaaatgcttgattatggtacgaaaatagtagcaggtgtgacg
cctggtaaaggtggtcaagttgttgaaggcgttcctgttttcaacactgttgaagaagct
aaaaatgaaactggggcaacggtttcagtcatttacgttccagcaccatttgctgcagac
tcaattttagaagcagctgatgcagacttagatatggttatttgtatcactgaacatatt
cctgtattagacatggttaaagttaaacgctacttacaaggtagaaaaacacgtttagtt
ggtccgaactgtccaggtgtgattacagcagatgaatgtaaaattggtattatgcctggc
tatattcacaaaaaaggtcatgttggtgtagtatctcgttcaggtacattaacatatgaa
gcagtgcaccaattgactgaagaaggtattggtcaaactacagctgttggtattggtgga
gacccagtcaacggaacaaactttattgatgttttaaaagcattcaatgaagatgacgaa
acgaaagcagttgttatgattggtgaaatcggtggtacggctgaagaagaagcagctgaa
tggattaaagcgaatatgacaaaaccagttgtaggctttatcggtggacaaacagcacct
cctggaaaacgtatgggacatgctggtgcaatcatttcaggtggtaaaggtactgctgaa
gagaaaattaaaacattaaatagttgtggtgtgaaaacagcggcaacaccttcagaaatt
ggttcaacattaattgaagctgctaaagaagcaggtatttatgaatcattattaactgtt
aataaataa