Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.107 UDP-glucose 4-epimerase (EC 5.1.3.2) [Staphylococcus aureus subsp. aureus COL]
ttggaaagagttttgataactggtggggctggttttattgggtcgcatttagtagatgat
ttacaacaagattatgatgtttatgttctagataactatagaacaggtaaacgagaaaat
attaaaagtttggctgacgatcatgtgtttgaattagatattcgtgaatatgatgcagtt
gaacaaatcatgaagacatatcaatttgattatgttattcatttagcagcattagttagt
gttgctgagtcggttgagaaacctatcttatctcaagaaataaacgtcgtagcaacatta
agattgttagaaatcattaaaaaatataataatcatataaaacgttttatctttgcttcg
tcagcagctgtttatggtgatcttcctgatttgcctaaaagtgatcaatcattaatctta
ccattatcaccatatgcaatagataaatattacggcgaacggacgacattaaattattgt
tcgttatataacataccaacagcggttgttaaattttttaatgtatttgggccaagacag
gatcctaagtcacaatattcaggtgtgatttcaaagatgttcgattcatttgagcataac
aagccatttacattttttggtgacggactgcaaactagagattttgtatatgtatatgat
gttgttcaatctgtacgcttaattatggaacacaaagatgcaattggacacggttataac
attggtacaggcacttttactaatttattagaggtttatcgtattattggtgaattatat
ggaaaatcagtcgagcatgaatttaaagaagcacgaaaaggagatattaagcattcttat
gcagatatttctaacttaaaggcattaggatttgttcctaaatatacagtagaaacaggt
ttaaaggattactttaattttgaggtagataatattgaagaagttacagctaaagaagtg
gaaatgtcgtga