Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.5.peg.671 Ribonucleotide reductase of class Ib (aerobic), alpha subunit (EC 1.17.4.1) [Staphylococcus aureus subsp. aureus NCTC 8325]
ttggtttacatttgagaaaataagtagcttcattatagttaatacaatgctgagataacc
atagtaaccatgttgttaaagcattttttaattggaatgactactttatttaaaagggtt
gaagaaagaaggtgatccaatgaaaataatatatttttcatttactggaaatgtccgtcg
ttttattaagagaacagaacttgaaaatacgcttgagattacagcagaaaattgtatgga
accagttcatgaaccgtttattatcgttactggcactattggatttggagaagtaccaga
acccgttcaatcttttttagaagttaatcatcaatacatcagaggtgtggcagctagcgg
taatcgaaattggggactaaatttcgcaaaagcgggtcgcacgatatcagaagagtataa
tgtccctttattaatgaagtttgagttacatggaaaaaacaaagacgttattgaatttaa
gaacaaggtgggtaattttaATGAAAACCATGGAAGAGAAAAAGTACAATCATATTGAAT
TAAATAATGAGGTCACTAAACGAAGAGAAGATGGATTCTTTAGTTTAGAAAAAGACCAAG
AAGCTTTAGTAGCTTATTTAGAAGAAGTAAAAGACAAAACAATCTTCTTCGACACTGAAA
TCGAGCGTTTACGTTATTTAGTAGACAACGATTTTTATTTCAATGTGTTTGATATTTATA
GTGAAGCGGATCTAATTGAAATCACTGATTATGCAAAATCAATCCCGTTTAATTTTGCAA
GTTATATGTCAGCTAGTAAATTTTTCAAAGATTACGCTTTGAAAACAAATGATAAAAGTC
AATACTTAGAAGACTATAATCAACACGTTGCCATTGTTGCTTTATACCTAGCAAATGGTA
ATAAAGCACAAGCTAAACAATTTATTTCTGCTATGGTTGAACAAAGATATCAACCAGCGA
CACCAACATTTTTAAACGCAGGCCGTGCGCGTCGTGGTGAGCTAGTGTCATGTTTCTTAT
TAGAAGTGGATGACAGCTTAAATTCAATTAACTTTATTGATTCAACTGCAAAACAATTAA
GTAAAATTGGGGGCGGCGTTGCAATTAACTTATCTAAATTGCGTGCACGTGGTGAAGCAA
TTAAAGGAATTAAAGGCGTAGCGAAAGGCGTTTTACCTATTGCTAAGTCACTTGAAGGTG
GCTTTAGCTATGCAGATCAACTTGGTCAACGCCCTGGTGCTGGTGCTGTGTACTTAAATA
TCTTCCATTATGATGTAGAAGAATTTTTAGATACTAAAAAAGTAAATGCGGATGAAGATT
TACGTTTATCTACAATATCAACTGGTTTAATTGTTCCATCTAAATTCTTCGATTTAGCTA
AAGAAGGTAAGGACTTTTATATGTTTGCACCTCATACAGTTAAAGAAGAATATGGTGTGA
CATTAGACGATATCGATTTAGAAAAATATTATGATGACATGGTTGCAAACCCAAATGTTG
AGAAAAAGAAAAAGAATGCGCGTGAAATGTTGAATTTAATTGCGCAAACACAATTACAAT
CAGGTTATCCATATTTAATGTTTAAAGATAATGCTAACAGAGTGCATCCGAATTCAAACA
TTGGACAAATTAAAATGAGTAACTTATGTACGGAAATTTTCCAACTACAAGAAACTTCAA
TTATTAATGACTATGGTATTGAAGACGAAATTAAACGTGATATTTCTTGTAACTTGGGCT
CATTAAATATTGTTAATGTAATGGAAAGCGGAAAATTCAGAGATTCAGTTCACTCTGGTA
TGGACGCATTAACTGTTGTGAGTGATGTAGCAAATATTCAAAATGCACCAGGAGTTAGAA
AAGCTAACAGTGAATTACATTCAGTTGGTCTTGGTGTGATGAATTTACACGGTTACCTAG
CAAAAAATAAAATTGGTTATGAGTCAGAAGAAGCAAAAGATTTTGCAAATATCTTCTTTA
TGATGATGAATTTCTACTCAATCGAACGTTCAATGGAAATCGCTAAAGAGCGTGGTATCA
AATATCAAGACTTTGAAAAGTCTGATTATGCTAATGGCAAATATTTCGAGTTCTATACAA
CTCAAGAATTTGAACCTCAATTCGAAAAAGTACGTGAATTATTCGATGGTATGGCTATTC
CTACTTCTGAGGATTGGAAGAAACTACAACAAGATGTTGAACAATATGGTTTATATCATG
CATATAGATTAGCAATTGCTCCAACACAAAGTATTTCTTATGTTCAAAATGCAACAAGTT
CTGTAATGCCAATCGTTGACCAAATTGAACGTCGTACTTATGGTAATGCGGAAACATTTT
ACCCTATGCCATTCTTATCACCACAAACAATGTGGTACTACAAATCAGCATTCAATACTG
ATCAGATGAAATTAATCGATTTAATTGCGACAATTCAAACGCATATTGACCAAGGTATCT
CAACGATCCTTTATGTTAATTCTGAAATTTCTACACGTGAGTTAGCAAGATTATATGTAT
ATGCGCACTATAAAGGATTAAAATCACTTTACTATACTAGAAATAAATTATTAAGTGTAG
AAGAATGTACAAGTTGTTCTATCTAAcaattaaatgttgaaaatgacaaacagctaatca
tctggtctgaattagcagatgattagactgctatgtctgtatttgtcaattattgagtaa
cattacaggaggaaattatattcatgatagctgttaattggaacacacaagaagatatga
cgaatatgttttggagacaaaatatatctcaaatgtgggttgaaacagaatttaaagtat
caaaagacattgcaagttggaagactttatctgaagctgaacaagacacatttaaaaaag
cattagctggtttaacaggcttagatacacatcaagcagatgatggcatgcctttagtta
tgctacatacgactgacttaaggaaaaaagcagtttattcatttatggcgatgatggagc
aaatacacgcgaaaagctattcacatattttcacaacactattaccatctagtgaaacaa
actacctattagatgaatgggttttagaggaaccccatttaaaata