Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.5.peg.535 repetative hypothetical protein , fig|282458.1.peg.574 homolog [Staphylococcus aureus subsp. aureus NCTC 8325]
tcgataggtaataaaaatgttcatgttattttaagaataaacgagtagtaaaaatgatcg
aaattggtagtatcgcatatttaaacggtggttcaaaaaaatataatcatatcttaaatc
aggaaaatagatagtaatgtttgaatataccaagtgaaaatgcccattgtgattgataaa
ggaaaaaactgttttaatttaaaaatgaaatatagagcgtgttattttgtatgatagctc
ttataacattggcgtttttaatccaatagtatggacggttttagctggttttgttgcgga
atctgtttagacaattcttaaaaattggacttttcatactaataaatttggattaagaga
taaaactaattggataagacattaaatagacgctgtttaaaaataccacagaaaaagctg
tagatagtgttggaacgatagttggtgaaggtacaaaaagtattggggatcatttaaaac
taatgaaacgggagtggtaaATGTTGCTTTGCGATGTCAGAGTCATTTATAAAAATCCGA
AATACAAAGTCATTCAACATAACGGTGAATACTTATTAGTCGATTTAGTAAGCACTTGGT
TCGTGTACTTTTTTCCTTTCATTAATTGGTTCATTCCAAAAAAGTACGCGATAATTAGCG
AAGAAGAATTTGAAAATTTAAATGTTGTTAAACCAAATAAAAATAATGTTTTCTGGTCAG
TTATAGGAAGTTCGGTTTTGTTTGGAGTTACTTTAAGGAAATACATACATGTTTTTGATG
TTCAATTAGATAAGCTAGTTGTAATGATATTGTGTGCTCTCGCTTTAATTTGTGTTATAG
TTTTTTATTTTAACTTAAATAGAAAGCTTAAGTTAAAAGTGTTTGATACAAATATTGAAA
AAAATAAGAGAGTTATATTAATACCAACGTTTAAACTTGGCTGTTTTTTAGTTTTCGGAT
ATATTTTCGCTGGAAGTTTTTCAATATTTTCATTAATTGCCCTTATGACAATCGAACCTC
AAAATATAATAATATTTATTTATTGGATTATGATGACAATGCTTTTCTTTTTGTTAAATA
TGACTTCGATAGGTAATGAAAAAGTTCGCGTTATAATGAAAAATAATTGAttacatttaa
aatattctaaatgttgtcgacacaatccttttaagacgctagtagaatttaaatgacttc
taatgtatatgaaagtgtatcaatataaaaccaattgaaaagaagtggagacattgcttt
gtgaaactgaaaatattaataagaatcccaaatatagaattatcaaatacaaagatgaat
atttgatgattgatttagtaagtacatggttagcactctttttcccaatgattaattggc
tgattccaaaaaagtacgtcaaaatcagcgaaaaagattttgaaactttaaacattgtga
agacagctaaaatcaattctttttggccagtggcaggaagtacggtcttatttggtgtta
tgttaagaaggtattcccatttatttatcgttaaatatgaatatagtatagtaattttaa
tttgttgcatcataatactaggtatttttctgttttttttatatttaaatcaaaagttaa
agttacaaat