Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.5.peg.2685 Mannose-6-phosphate isomerase (EC 5.3.1.8) [Staphylococcus aureus subsp. aureus NCTC 8325]
tgacaatgtagataacaccgcgaaacattcacatctcaataaaccttctcatgtttttga
tcaacaaactatgataattactgatcacgacatgtctcgaaacgaagcaattgatatgtt
gattcataaacttaaaatttgccgttatgtagagcacacatcgcatttaaaaaatgcaat
actagaacgtgaaatggagtctacgacagctattggcatgaacgtggccattccacatgc
aaagtctgatgttgtaaaacaaccgattgtagctgttatgaaaaataatcatggtgttaa
atgggacagtctagatggtagtctacctcaattgatattcttaattgccgtaccaaacaa
cagtcaggatacacatttaaaaatacttcagcgcttatctaaagcgttaatgaatgatga
gacacgccaatcactaattaatgcaaacagtactacagaaatttataacttattaatgaa
aatatagaggagttttaactATGGCATTATTTTTACAACCCGTTTTTAAAGACAGAATTT
GGGGCGGTCATGCATTAAAAGCATTTAACTATGATATCCCTAATGAAACAACTGGTGAAT
GCTGGGCAATTTCTGCACATCCAAATGGTCCTAATACAATTATCAATGGTCCATACAAGG
ATATGACCCTAGATCAACTTTGGTCACAACATCGTGAATTATTCGATAATGATTCACGAG
ATAGTTTCCCTCTGCTAACTAAAGTATTAGATGCCAATGATAAATTATCTGTTCAAGTTC
ACCCAGATGATGACTACGCTTTAAAACACGAAGGCGAACTAGGTAAAACAGAATGTTGGT
ATATTTTAGATGCAGCCCCAGGTGCTGAAATTATATATGGCGTACATGCACATAATAAAC
AGACGTTAATAGACATGATTGATAATCATGAATTTGACAGTCTTTTCAAACGTATACCTG
TTAAGCCCGGTGACTTTTATTATGTTCCTGCTGGCACTGTCCATGCCATTGGTTCGGGTA
TTTTAATTTTAGAGACACAACAATCCTCCGATACGACATACCGTATTTATGACTATGATA
GACGAGATCAAAATGGTCAATTGCGTGATTTGCACTTAGAGCAAAGTAAAGATGTGATTG
AATTAGGCAATCATGAACCAAATACTACTCCTATAACAACTCACATCGACACACACACTG
TAACTCAATTTGTAGATAATCAATATTTTGCAGTATATAAATGGGATATTCATGGAGATT
TAAAATTCAATAAACCACATGCTTATTGCTTAGTTACAATTATCGATGGTACTGGTACTT
TAACAGTAAACGATAAGCACTATGACATCCAAAAAGGTTCTAGCTTTATTTTAACTACGG
AAGACGAGGATATTCACTTTGTCGGTAATATTAGTGCTATAGTAAGTCATCCTGGATAAt
agcaatgataacaaccgtcccataaaagacagaaattactatctcttctgtctaaaaaca
taaaaatccacacattaaggagctataaccctaatgtgtggatttaatttttattctgta
acgttactttggtcaactttttcagatacgcgcttcatcaatggatctgttacaggtttt
aaaattaaacctacaacgaagaatcctataccaaataacgttaatataattaattttgta
attaggatttccggaacaataccgcctactgtttcacgtaatgaatcaattgcatacgta
aatggtaagtatggcgaaatgttttggaaaaattgtggcgtagtttgaattgggaatgtt
cccccaccacctgcaatttgtaatacaagcaatacgattgcaatggctttacctgggtta
ccaagtaatgatacgcacgtatatacgattgagttgaaaataatcgaacagaaaatcgtt
ataagtacaaataatacag