Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.5.peg.1144 SSU ribosomal protein S15p (S13e) [Staphylococcus aureus subsp. aureus NCTC 8325]
aaggtgaaaaaaggggaagaactattggcttcccaacagctaacattcaacctagtgatg
attatttgttacctcgtaaaggtgtttatgctgttagtattgaaatcggcactgaaaata
aattatatcgaggggtagctaacataggtgtaaagccaacatttcatgatcctaacaaag
cagaagttgtcatcgaagtgaatatctttgactttgaggataatatttatggtgaacgag
tgaccgtgaattggcatcatttcttacgtcctgagattaaatttgatggtatcgacccat
tagttaaacaaatgaacgatgataaatcgcgtgctaaatatttattagcagttgattttg
gtgatgaagtagcttataatatctagagttgcgtatagttatataaacaatctataccac
acctttttcttagtaggtcgaatctccaacgcctaactcggattaaggagtattcaaaca
ttttaaggaggaaattgattATGGCAATTTCACAAGAACGTAAAAACGAAATCATTAAAG
AATACCGTGTACACGAAACTGATACTGGTTCACCAGAAGTACAAATCGCTGTACTTACTG
CAGAAATCAACGCAGTAAACGAACACTTACGTACACACAAAAAAGACCACCATTCACGTC
GTGGATTATTAAAAATGGTAGGTCGTCGTAGACATTTATTAAACTACTTACGTAGTAAAG
ATATTCAACGTTACCGTGAATTAATTAAATCACTTGGTATCCGTCGTTAAtcttaatata
acgtctttgaggttggggcatatttatgttccaaccttaatttatattaaaaaagctttt
tacaaatattaacatttattatatgttaagctaatattgagtgaataataaggttacaat
gagataaagatgatataagtacacctagagtaataatcaagatattaaaaataaagtatg
tttttttaaaaaatataacttatatttatactgataagggtgggacgataagtctatttt
gtaaataatagatggatatcccgctctctttttttccaattcaatattttataactaata
ttaaaatacgataataaatgatatgatataactattagattcaagagaggagatttataa
tgtctcaagaaaagaaagtttttaaaactgaatgggcaggaagatctttaacgattgaaa
cagggcaattagctaaacaagcaaatggcgctgtattggttcgttatggagatacagtcg
tgttatcgac