Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93061.3.peg.587 Doubtful CDS. No database matches [Staphylococcus aureus subsp. aureus NCTC 8325]
atgaaagatagtgaaaatctcgtgttttttggttttgaggtgttgtttgtattttataaa
atggcttacatatatgaagcgttgattaagtatggaattgttaattaa