Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|868207.3.peg.4387 Dihydroxy-acid dehydratase (EC 4.2.1.9) [Escherichia coli DEC15B]
atgcctaagtaccgttccgccaccaccactcatggtcgtaatatggcgggtgctcgtgcg
ctgtggcgcgccaccggaatgaccgacgccgatttcggtaagccgattatcgcggttgtg
aactcgttcacccaatttgtaccgggtcacgtccatctgcgcgatctcggtaaactggtc
gccgaacaaattgaagcggctggcggcgttgccaaagagttcaacaccattgcggtggat
gatgggattgccatgggccacggggggatgctttattcactgccatctcgcgaactgatc
gctgattccgttgagtatatggtcaacgcccactgcgccgacgccatggtctgcatctct
aactgcgacaaaatcaccccggggatgctgatggcttccctgcgcctgaatattccggtg
atctttgtttccggcggcccgatggaggccgggaaaaccaaactgtccgatcagataatc
aaactcgatctggttgatgcgatgatccagggcgcagacccgaaagtttctgactcccag
agcgatcaggttgaacgttccgcctgcccaacctgcggttcctgctccgggatgtttacc
gctaactcaatgaactgcctgaccgaagcgctgggcctgtcgcagccgggcaacggctcg
ctgctggcaacccacgccgaccgtaagcagctgttccttaatgctggtaaacgcattgtt
gaattgaccaaacgttattacgagcaaaacgacgaaagtgcactgccgcgtaatatcgcc
agtaaggcggcgtttgaaaacgccatgacgctggatatcgcgatgggtggatcgactaac
accgtacttcacctgctggcggcggcgcaggaagcggaaatcgacttcaccatgagtgat
atcgataagctttcccgcaaggttccacagctgtgtaaagttgcgccgagcacccagaaa
taccatatggaagatgttcaccgtgctggtggtgttatcggtattctcggcgaactggat
cgcgcggggttactgaaccgtgatgtgaaaaacgtacttggcctgacgttgccgcaaacg
ctggaacaatacgacgttatgctgacccaggatgacgcggtaaaaaatatgttccgcgcc
ggccctgcgggtattcgtaccacacaggcattctcgcaggattgccgttgggattctctc
gatgacgatcgcgccaatggctgtatccgctcgctggaacacgcctacagcaaagacggc
ggcctggcggtgctctacggtaatttcgcagaaaacggctgcatcgttaaaaccgcgggc
gtcgatgacagcatcctcaaattcaccggcccggcgaaagtgtacgaaagccaggacgac
gcggtagaagcgatcctcggtggcaaagttgtcgcgggcgatgtggtggtgatccgctat
gaaggcccgaaaggcggccctggcatgcaggaaatgctctacccaaccagcttcctgaaa
tcaatgggtctcggtaaagcctgtgcgctgatcaccgacggtcgtttctctggcggcacc
tctggtctttccatcggccacgtctcaccggaagcggcaagcggcggcagcattggcctg
attgaagatggtgacctgatcgctatcgacatcccgaaccgtggcattcagttacaggta
agcgatgccgaactggcggcgcgtcgtgaagcgcaggaagctcggggtgacaaagcctgg
acgccgaaaaaccgtgaacgtcaggtttcctttgccctgcgtgcctacgccagcctggcg
accagcgccgacaaaggtgcggtgcgcgataaatcgaaactggggggttaa