Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|868203.3.peg.182 2-isopropylmalate synthase (EC 2.3.3.13) [Escherichia coli DEC14C]
attcaccaaatcaatatcaaaaaaatcgcaaaacatataattcaatacaaatcatcagga
taggttttgcaacgcgtgcattttgtcccctttttcctcgttgattagatgcaaaaattt
atgctgaaatatgtcaaccgatgaaaagcgtcggtagttaagcagaaattaatatcgctt
actttaaccaccgcagcacaattagctaattttacggatgcagaactcacgctggcggga
cgtttttattgcgtcagggttgacatccgtttttgtatccagtaactctaaaagcatatc
gcattcatctggagctgatttaatgactcacatcgttcgctttatcggtctactactact
aaacgcatcttctttgcgcggtagacgagtgagcggcatccagcattaagccagcacgca
gtcaaacaaaaaacccgcgccattgcgcgggttttttatgcccgaagcgaggcgctctaa
aagagacaaggacccaaaccATGAGCCAGCAAGTCATTATTTTCGATACCACATTGCGCG
ACGGTGAACAGGCGTTACAGGCAAGCTTGAGTGTGAAAGAAAAACTGCAAATTGCGCTGG
CCCTTGAGCGTATGGGTGTTGACGTGATGGAAGTCGGTTTCCCCGTCTCTTCGCCGGGCG
ATTTTGAATCGGTGCAAACCATCGCCCGCCAGGTTAAAAACAGCCGCGTATGTGCGTTAG
CTCGCTGCGTGGAGAAAGATATCGACGTGGCGGCCGAATCCCTGAAAGTCGCCGAAGCCT
TCCGTATTCATACCTTTATTGCCACTTCGCCAATGCACATCGCCACCAAGCTGCGCAGCA
CGCTGGATGAAGTGATCGAACGCGCTATCTATATGGTGAAACGCGCCCGTAATTACACCG
ATGATGTTGAATTTTCTTGCGAAGATGCCGGGCGTACACCCATTGCCGATCTGGCGCGAG
TGGTCGAAGCGGCGATTAATGCCGGTGCCACCACCATCAACATTCCGGACACCGTGGGCT
ACACCATGCCGTTTGAGTTCGCCGGAATCATCAGCGGCCTGTATGAACGCGTACCTAACA
TCGACAAAGCCATTATTTCCGTACATACCCACGACGATTTAGGCCTGGCGGTCGGCAACT
CACTGGCGGCGGTACATGCCGGTGCACGCCAGGTGGAAGGTGCAATGAACGGGATCGGCG
AGCGTGCCGGTAACTGTTCGCTGGAAGAAGTCATCATGGCGATTAAAGTTCGTAAGGATA
TTCTCAACGTCCACACCGCCATTAATCACCAGGAGATATGGCGCACCAGCCAGTTAGTTA
GCCAGATTTGTAATATGCCGATCCCGGCAAACAAAGCCATTGTTGGCAGCGGCGCATTCG
CTCACTCCTCCGGTATCCACCAGGATGGCGTGCTGAAAAACCGCGAAAACTACGAAATCA
TGACACCAGAATCTATTGGTCTGAACCAAATCCAGCTGAATCTGACCTCTCGTTCGGGGC
GTGCGGCGGTGAAACATCGCATGGATGAGATGGGGTATAAAGAAAGTGAATATAATTTAG
ACAATTTGTACGATGCTTTCCTGAAGCTGGCGGACAAAAAAGGTCAGGTGTTTGATTACG
ATCTGGAGGCGCTGGCCTTCATCGGTAAGCAGCAAGAAGAGCCGGAGCATTTCCGTCTGG
ATTACTTCAGCGTGCAGTCTGGCTCTAACGATATCGCCACCGCCGCCGTCAAACTGGCCT
GTGGCGAAGAAGTCAAAGCAGAAGCCGCCAACGGTAACGGTCCGGTCGATGCCGTCTATC
AGGCAATTAACCGCATCACTGACTATAACGTCGAACTGGTGAAATACAGCCTGACCGCCA
AAGGTCACGGTAAAGATGCGCTGGGTCAGGTGGATATTGTCGCCAACTACAACGGTCGCC
GCTTCCACGGCGTCGGCCTGGCCACCGATATTGTCGAGTCCTCCGCCAAAGCCATGGTGC
ACGTACTGAACAATATCTGGCGTGCCGCAGAAGTCGAAAAAGAGTTGCAACGCAAAGCTC
AACACAACGAAAACAACAAGGAAACCGTGTGAtgtcgaagaattaccatattgccgtatt
gccgggggacggtattggtccggaagtgatgacccaggcgctgaaagtgctggatgccgt
gcgcaaccgctttgcgatgcgcatcaccaccagccattacgatgtaggcggcgcagccat
tgataaccacgggcaaccactgccgcctgcgacggttgaaggttgtgagcaagccgatgc
cgtgctgtttggctcggtaggcggtccgaaatgggaacatttaccaccagaccagcaacc
agaacgcggcgcgctgttgcctttgcgtaagcacttcaaattattcagcaacctgcgccc
ggcaaaactgtatcaggggctggaagcattctgtccgctgcgtgcagacattgccgctaa
cggcttcgacatcctgtgcgtgcgcgaactgaccggcggcatctatttcggtcagccaaa
aggccgcgaaggtagcggacaatatgaaaaagcgtttgataccgaggtgtat