Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|868181.3.peg.4885 Branched-chain amino acid ABC transporter, ATP-binding protein LivF [Escherichia coli DEC10B]
atggaaaaagtcatgttgtcctttgacaaagtcagcgcccactacggcaaaatccaggcg
ctgcatgaggtgagcctgcatatcaatcagggcgagattgtcaccctcattggcgcgaac
ggggcggggaaaaccaccttgctcggcacgttatgcggcgatccgcgcgctaccagcggg
cgaattgtgtttgatgataaagacattaccgactggcagacggcgaaaatcatgcgcgaa
gcggtagcgattgtcccggaagggcgtcgcgtcttctcgcggatgacggtggaagagaac
ctggcgatgggcggcttttttgccgaacgcgaccagttccaggagcgcataaagtgggtg
tatgaactgtttccacgtctgcatgagcgccgtgttcagcgggcaggcaccatgtccggc
ggtgagcaacaaatgctggcgattggtcgcgcgctgatgagcaacccgcgtttgctgcta
cttgatgagccatcgctcggtcttgcgccgattatcatccagcaaattttcgacaccatc
gagcagctgcgcgagcaggggatgactatcttcctcgtcgagcagaacgccaaccaggcg
ctaaagctggcggatcgcggctacgtgctggaaaacggccatgtggtgctctccgatacc
ggcgacgcgctgctggcgaacgaagcagtgagaagtgcgtatttaggcgggtaa