Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|868163.3.peg.4105 Branched-chain amino acid ABC transporter, permease protein LivM [Escherichia coli DEC6D]
gtggtggggcatagcgaaaacttctctgcctctattaccaccatgcaggcggtgatctgg
attgttaccttcctcgccatgctggcgctgacgattttcattcgctattcccgcatgggt
cgcgcgtgtcgtgcctgcgcggaagatctgaaaatggcgagtctgcttggcattaacacc
gaccgggtgattgcgctgacctttgtgattggcgcggcgatggcggcggtggcgggtgtg
ctgctcggtcagttctacggcgtcattaacccctacatcggctttatggccgggatgaaa
gcctttaccgcggcggtgctcggtgggattggcagcattccgggagcgatgattggcggc
ctgattctggggattgcggaggcgctctcttctgcctatctgagtacggaatataaagat
gtggtctcattcgccctgctgattctggtgctgctggtgatgccgaccggtattctgggt
cgcccggaggtagagaaagtATGAAACCGATGCATATTGCAATGGCGCTGCTCTCTGCCG
CGATGTTCTTTGTGCTGGCGGGCGTCTTTATGGGCGTGCAACTGGAACTGGATGGCACCA
AACTGGTGGTCGACACGGCTTCGGATGTCCGTTGGCAGTGGGTGTTTATCGGCACGGCGG
TGGTCTTTTTCTTCCAGCTTTTGCGACCGGCTTTCCAGAAAGGGTTGAAAAGCGTTTCCG
GACCGAAGTTTATTCTGCCCGCCATTGATGGCTCCACGGTGAAGCAGAAACTGTTCCTCG
TGGCGCTGTTGGTGCTTGCGGTGGCGTGGCCGTTTATGGTTTCACGCGGGACGGTGGATA
TTGCCACCCTGACCATGATCTACATTATCCTCGGTCTCGGGCTGAACGTGGTTGTTGGTC
TTTCTGGTCTGCTGGTGCTGGGGTACGGCGGTTTTTACGCCATCGGCGCTTACACTTTTG
CGCTGCTCAATCACTATTACGGCTTGGGCTTCTGGACCTGCCTGCCGATTGCTGGATTAA
TGGCAGCGGCGGCGGGCTTCCTGCTCGGTTTTCCGGTGCTGCGTTTGCGCGGTGACTATC
TGGCGATCGTTACCCTCGGTTTCGGCGAAATTGTGCGCATATTGCTGCTCAATAACACCG
AAATTACCGGCGGCCCGAACGGAATCAGTCAGATCCCGAAACCGACACTCTTCGGACTCG
AGTTCAGCCGTACCGCTCGTGAAGGCGGCTGGGACACGTTCAGTAATTTCTTTGGCCTGA
AATACGATCCCTCCGATCGTGTCATCTTCCTCTACCTGGTGGCGTTGCTGCTGGTGGTGC
TAAGCCTGTTTGTCATTAACCGCCTGCTGCGGATGCCGCTGGGGCGTGCGTGGGAAGCGT
TGCGTGAAGATGAAATCGCCTGCCGTTCGCTGGGCTTAAGCCCGCGTCGTATCAAGCTGA
CTGCCTTTACCATAAGTGCCGCGTTTGCCGGTTTTGCCGGAACGCTGTTTGCGGCGCGTC
AGGGCTTTGTCAGCCCGGAATCCTTCACCTTTGCCGAATCGGCGTTTGTGCTGGCGATAG
TGGTGCTCGGCGGTATGGGCTCGCAATTTGCGGTGATTCTGGCGGCAATTTTGCTGGTGG
TGTCGCGCGAGTTGATGCGTGATTTCAACGAATACAGCATGTTAATGCTCGGTGGTTTGA
TGGTGCTGATGATGATCTGGCGTCCGCAGGGCTTGCTGCCCATGACGCGCCCGCAACTGA
AGCTGAAAAACGGCGCAGCGAAAGGAGAGCAGGCATGAgtcagccattattatctgttaa
cggcctgatgatgcgcttcggcggcctgctggcggtgaacaacgtcaatcttgaactgta
cccgcaggagatcgtctcgttaatcggccctaacggtgccggaaaaaccacggtttttaa
ctgtctgaccggattctacaaacccaccggcggcaccattttactgcgcgatcagcacct
ggaaggtttaccggggcagcaaattgcccgcatgggcgtggtgcgcaccttccagcatgt
gcgtctgttccgtgaaatgacggtaattgaaaacctgctggtggcgcagcatcagcaact
gaaaaccgggctgttctctggcctgttgaaaacgccatccttccgtcgcgcccagagcga
agcgctcgaccgcgccgcgacctggcttgagcgcattggtttgctggaacacgccaaccg
tcaggcgagtaacctggcctatggtgaccagcgccgtcttgagattgcccgctgcatg