Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|644279.4.peg.1055 membrane protein, putative [Staphylococcus aureus subsp. aureus 132]
acattgacatcttgcttcaatcaattcgcaacgtgcattatttatttgtgaaattaatgt
acgtgcttgatcagtcaaaattaattctttacatcttaaatcttcgctagattgttgact
tgtgatgtaccctttcaaaactaatttcttaatccaccttgaaactatagattgttccct
gctaatcttcatcgtcaaatcatactgtgataagcgatcgtaattaaataaaatacggag
aagttctagctgttcagatttgatatccgtgcgttgtccaaatcttctattcactaagtt
taagtcattgttagtcagtgtaataagtttttcaagttgtttatacatgttgttctactc
cactacatattatttataatattatatgctttttttataatttttacaatactattcgac
acaatagacaaatttgttgcataactaatacaaaatataataaattagtaagagtcttat
ggacataaaggagataaaatATGACTTCATTAAAAGAGAGAGATTATTTTTTTGACAACG
CAAGAGCAATTTTAATATTATTAGTCGTATTTGGACATATGTTACAACCCTACACTAGTG
GCGATAAATATTTATCAGCATTATACCTAGTTATTTATAGTTTCCATATGCCAACATTTT
TGTTTATATCTGGTTATTTCGCGAAAAATATTGATAAACCATACTATTTAGAAAAAATTT
CAAAACGTTTGATAGTACCTTATATGATATTTTTTGCATTCTTTTCAATTTATTATTTCT
TAACAGGTAAAAGTGACGAATTACAACTTGATCCTTTTAACCCAGTATTTGCGTTATGGT
TTTTGATCACGCTATTTTTCTTTCATGTCATTTTAGTAATAGTTAGAAGATTTAATCCAT
ATAAAGTGCTATCAGTTTCAATTATTATATCTATTGGAGCAGGTTTTTCAGATAACATCG
ATAGCTACTTAAGCATTTCAAGGACAATCGTATTTTTCCCAATATTTTATCTAGGTTACA
TTTTCACCAAAAAACATACGGCTATTTTTAAAAATAAAAAACTAATACCAGTATCTATCA
TTACCTTTATTTTGTTTTTTATCGTTTACGTGATTCATCCTATCAATGCAGATTGGTTAT
TGGGAAGTTCACCATATACTTCACTTGAAAATGAAGGACAGAGTATATTCAGTCCTTTTA
AACGACTTATATTATATGGAATTATATTAATCGCAATGACTGCGTTTCTAAATTTAATGT
CAACAAAGAAAAAATTATATACTTATATTGGTAGTCGTACGCTATACGTATATTTATTAC
ATGGTTTAATTATTGGCATTGTTAGAGGATTTGAATGGTACCCATTCGATAATCCTATAT
CATTAATGACTTATCTTTATTTAATAAGTATATCTGTAATCATCGTATATGTATTATCTA
CAAACTTTGTTTGTAAATGGACAAATCCAATAATTAATTTACAAAGACCATCACAGTTTA
AAGATTCATAAttttatactgtctaagtacattaactgtaaccactttattcattttgaa
aagtagttactacagtgtatttagacatttttcgtttttcaaataaagcttaagtaattt
acccttttttgctttaaaagtatgttatgatattattaatttctaaatttttagacaata
tttgatttatatttgaggtgtcacaaatgaaactttctttaaattctaattctaaatatt
taagagcaccaagtattcgccaattttcaaatcgtatgaataatttggatgattgtgtta
atttaactattggccaaccagacttcccgatgcctgatgttgtgaaaaaggcatatattg
atgctattaacaatgacaagacatcatactctcacaataaagggttattagaaactcgcg
aagcaattagtcaatacttcaaaaatcgttatcatttttcctatgatcctgaagaaatta
ttgtgacaaatggagcaagtgaagcaataga