Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585152.3.peg.2331 putative esterase [Staphylococcus aureus subsp. aureus D139]
ttaaaatttttaatgccatcaaaatctacagattctttggtgaagacaatattaaaaatg
ggttgtttccacatactgtatccagcgattgcggttaatataacaacaatgatttgaata
atcatgcttaccaatgaacgttttttcttaccatatcgcttaccacgatgaatattcggt
tgttgaaatgtctcatcaaatggttctaatcgttgatttggatttgtcatgcaaggcacc
tccgtataaagttcttttctttacttatcaatatgtctagttgtctgttataatgatgaa
aaatcactgttcaattgtagtcttaaatttgaaagtgaaaaagaaaatatcttctacatt
atatactttttttggcaaagaatgtaggggatagacaatcattggatacataaaatatat
aaaggtaggttaagacattgattagaaaccgtgttatgaatagcgttgtcaataaatatt
tgcttcacaatcgctcgattATGTTTAAAAATGATCAAGATGTTGAAAGATTTTTTTATA
AAAGAGAAATTGAAAATAGAAAAAAACATAAGCAGCCTTCAACATTAAATGTTAAAGCAA
ATTTAGAAAAATTATCATTAGATGATATGCAAGTCTTTCGCTTTAATTTCAGACATCAAA
TTGATAAGAAAATTTTATATATTCACGGTGGATTCAATGCACTACAACCATCACCGTTCC
ATTGGAGATTGTTGGATAAAATCACTTTAAGTACATTATATGAGGTTGTACTGCCTATCT
ATCCAAAGACACCAGAGTTTCATATTGACGACACTTTCCAAGCGATACAACGTGTTTATG
ATCAATTAGTATCTGAAGTAGGCCATCAAAATGTCGTAGTCATGGGTGATGGTTCAGGTG
GTGCACTGGCATTATCCTTTGTACAATCTCTTTTAGACAATCAACAGCCATTACCGAATA
AATTGTATTTAATCTCACCAATTTTAGATGCAACACTATCTAATAAAGATATTTCGGACG
CTTTAATCGAACAAGATGCGGTTCTAAGTCAGTTTGGTGTCAATGAGATTATGAAAAAAT
GGGCGAATGGCCTACCATTAACAGATAAGCGCATATCGCCAATTAATGGCACAATAGAAG
GATTACCACCAGTTTATATGTTTGGTGGTGGACGTGAAATGACACATCCTGATATGAAGC
TGTTCGAACAAATGATGTTGCAACATCATCAATACATTGAGTTTTATGATTATCCTAAGA
TGGTACATGATTTTCCAATTTATCCAATTAGACAATCACATAAAGCTATTAAACAAATTG
CCAAATCGATAGATGAGGATGTAACACAAAATAACTAAtaacatacaattgacccagtta
cgatttcatggaagatgatatttgacatgaaaacgcaattgggttttgtttttgaaaata
tagcaaggattatatagactaattgttaatgcgcttctgagtgaaaatcaccaataagtg
tattgatatgcgtgatgataaagtattgccctttaatttgataaaattgatctaaaaaat
tatcgaattgacgtggaatatcactaagttctgcaaaattagctgttttatcataattgc
gatgagcaacctcattttgaaatttatcataatgttctaagaaatgttgatcttcaagct
gttgttccacaatagtcataatattatcgatggcttgcttttgtccttgaacataagcca
tatgcacgccacgcttaagtagctgatttgctggtccgttaatgtataaccctttttgtg
catttaattctgttaattcaaacttaacatcatctaataaatctagtaattcgatatg