Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585151.3.peg.2336 putative esterase [Staphylococcus aureus subsp. aureus C427]
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcattg
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgacactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggccatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagacaatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggatgctttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaaatgggcgaatggcctaccatta
acagataagcgcatatcaccaattaatggcacaatagaaggattaccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctgttcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaacaactaa