Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585151.3.peg.1732 Hypothetical SAV0788 homolog in superantigen-encoding pathogenicity islands SaPI [Staphylococcus aureus subsp. aureus C427]
tgataagtacaacaataagcaacaaatggcgtaagggggcttaactaatgttcaacatta
atatagacgaacaagaagcacgcgagttattagaacaagctattaatgtacgtgtagaag
aattagcgaaagagaaatatttcatgacttacaaagagttgtctaactatctgaatttaa
gtaagcctactattgaagaattacttattaataatggcatgaaatattatatggtcggat
ctacgtacagattcaaaaagtttgatgtagatgaattcatggaacagcttactgctcata
tgaatatccagaataacgactttaaacaagtcaatatcaaaaagttattggaggcaaggc
aatgaaaatgtatttagcttatatctgcttagtttcattgttaacaattttattactagc
aatatctaacatgtatgtcgcttttagcgtttatgcttggctaataactttaggatgtaa
tttaacaggaggattagaaaATGAATAATGAACAAAAAGAAGTGATTAAAGATATTTATA
GCAGTTTGGAATCAGTAGCTAATAACAAATCAGAGGTATACATCCATGAATTTAAATGTG
GTGAGAAAGAACGGACAGAGACAGTAAACCGTGAGCAACACTTACAAGCGATTATCGAGT
GGACATTGCAACAAATAGAAAATAATTTTGAATTTGAAGAGGAGAATGAATAAgatgaat
aaattaactaaacaggaatacaaaaacattgaaaataaattgaattacgatcatatggta
aatggtaaaaaacgcactaataaaataaacaaactcttacaaagagaacatgatagagat
gcttcaattattaaaagtgaataccctagactaagtgatagtgagatatcagaagttatt
gtggattatagaacttataaggagcttgtaatagcaacagaaacttttgttgatttccct
ataaattatgaggattcaaatgtatgtcagttcattactaaggaagatattgaagatctg
aaatcagcaattgaagaaatgacaagtttcgttgaaaatttggaggaattataaatgaat
tgggaaattaaagatttaatgtgtgacattgaagtgataaaacaaaaaattaatgatgta
gctaccaaacatgcttggtttgttgaagatagatttgtaaaaaatgaattagaaacaaaa
cgggaacatatta