Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585150.3.peg.743 putative esterase [Staphylococcus aureus subsp. aureus C160]
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcattg
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgacactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggccatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagacaatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggatgctttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaaatgggcgaatggcctaccatta
acagataagcgcatatcaccaattaatggcacaatagaaggattaccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctgttcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaacaactaa