Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|585146.3.peg.195 putative esterase [Staphylococcus aureus subsp. aureus 68-397]
ttaaaatttttaatgccatcaaaatttacagattctttggtgaagacaatattaaaaatg
ggttgtttccacatgctgtatccagcgattgcggttaatataaaaacaatgatttgaata
atcatgcttaccaatgaacgttttttcttaccatatcgcttaccacgatgaatattcggt
tgttgaaatgtctcatcaaatggttctaatcgttgatttggatttgtcatacaaggcacc
tccgtataaagttcttttctttacttatcaatatgtctagttgtctgttataatgatgaa
aaatcactgttcaattgtagtcttaaatttgaaagtgaaaaagaaaatatcttctacatt
atatactttttttggcaaagaatgtaggggatagacaatcattggatacataaaatatat
aaaggtaggttaagacattgattagaaaccgtgttatgaatagcgttgtcaataaatatt
tgcttcacaatcgctcgattATGTTTAAAAATGATCAAGATGTTGAAAGATTTTTTTATA
AAAGAGAAATTGAAAATAGAAAAAAACATAAGCAGCCTTCAACATTAAATGTTAAAGCAA
ATTTAGAAAAATTATCATTGGATGATATGCAAGTCTTTCGCTTTAATTTCAGACATCAAA
TTGATAAGAAAATTTTATATATTCACGGTGGATTCAATGCACTACAACCATCACCGTTCC
ATTGGAGATTGTTGGATAAAATCACTTTAAGTACATTATATGAGGTTGTACTGCCTATCT
ATCCAAAGACACCAGAGTTTCATATTGACGACACTTTCCAAGCGATACAACGTGTTTATG
ATCAATTAGTATCTGAAGTAGGCCATCAAAATGTCGTAGTCATGGGTGATGGTTCAGGTG
GTGCACTGGCATTATCCTTTGTACAATCTCTTTTAGACAATCAACAGCCATTACCGAATA
AATTGTATTTAATCTCACCAATTTTAGATGCAACACTATCTAATAAAGATATTTCGGATG
CTTTAATCGAACAAGATGCGGTTCTAAGTCAGTTTGGTGTCAATGAGATTATGAAAAAAT
GGGCGAATGGCCTACCATTAACAGATAAGCGCATATCACCAATTAATGGCACAATAGAAG
GATTACCACCAGTTTATATGTTTGGTGGTGGACGTGAAATGACACATCCTGATATGAAGC
TGTTCGAACAAATGATGTTGCAACATCATCAATACATTGAGTTTTATGATTATCCTAAGA
TGGTACATGATTTTCCAATTTATCCAATTAGACAATCACATAAAGCTATTAAACAAATTG
CCAAATCGATAGATGAGGATGTAACACAAAACAACTAAtaacatataaatgacccagtta
cgatttcatggtagaagatatttaacatgaaaacgcaactgggttttgtttttgaaaata
tagcaaggattatatagactaattgttaatgagcttctgagtgaaaatcaccaataagtg
tattgatatgtgtgatgataaagtattgccctttaatttgataaaattgatctaaaaaat
tatcgaattgacgtggaatatcactaagttctgcaaagttagctgttttatcataattgc
gatgagcaacctcattttgaaatttatcataatgttctaggaaatgttgatcttcaagct
gttgttccacaatagtcataatattatcgatagcttgcttttgtccttgaacataagcca
tatgcacgccacgcttaagtaactgatttgctggtccgttaatgtataaccctttttgtg
catttaattctgttaattcaaacttaacatcatctaataaatctagtagttcgatatg