Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|553592.3.peg.991 putative esterase [Staphylococcus aureus A9763]
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcatta
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgatactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggacatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagataatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggacgccttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaaatgggcgaatggcctaccatta
acagataagcgcatatcgccaattaatggcacaatagaaggattgccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctattcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaataactaa