Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|553583.3.peg.1244 putative esterase [Staphylococcus aureus A9635]
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcatta
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgacactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggccatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagacaatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggacgctttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaagtgggcgaatggcctaccatta
acagataagcgcatatcgccgattaatggcacaatagaaggattaccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctattcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaataactaa