Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|546342.3.peg.1020 membrane protein, putative [Staphylococcus aureus subsp. aureus str. JKD6008]
atgacttcattaaaagagagagattatttttttgacaacgcaagagcaattttaatatta
ttagtcgtatttggacatatgttacaaccctacactagtggcgataaatatttatcagca
ttatacctagttatttatagtttccatatgccaacatttttgtttatatctggttatttc
gcgaaaaatattgataaaccatactatttagaaaaaatttcaaaacgtttgatagtacct
tatatgatattttttgcattcttttcaatttattatttcttaacaggtaaaagtgacgaa
ttacaacttgatccttttaacccagtatttgcgttatggtttttgatcacgctatttttc
tttcatgtcattttagtaatagttagaagatttaatccatataaagtgctatcagtttca
attattatatctattggagcaggtttttcagataacatcgatagctacttaagcatttca
aggacaatcgtatttttcccaatattttatctaggttacattttcaccaaaaaacatacg
gctatttttaaaaataaaaaactaataccagtatctatcattacctttattttgtttttt
atcgtttacgtgattcatcctatcaatgcagattggttattgggaagttcaccatatact
tcacttgaaaatgaaggacagagtatattcagtccttttaaacgacttatattatatgga
attatattaatcgcaatgactgcgtttctaaatttaatgtcaacaaagaaaaaattatat
acttatattggtagtcgtacgctatacgtatatttattacatggtttaattattggcatt
gttagaggatttgaatggtacccattcgataatcctatatcattaatgacttatctttat
ttaataagtatatctgtaatcatcgtatatgtattatctacaaactttgtttgtaaatgg
acaaatccaataattaatttacaaagaccatcacagtttaaagattcataa