Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|483215.6.peg.430 Cysteine synthase (EC 2.5.1.47) [Bacteroides finegoldii DSM 17565]
gtggggaatactcctctgatggagctttccggttattgtggtaagtatggtctggaacaa
aatattattgccaaactggaggcctttaatccggcgggaagtgtgaaagacagggtggct
ctttcgatgattgaagatgcggaggcacgtggggtattgaagcccggcgcaacgataatc
gaaccgacaagcggaaatacaggtgtcggactggcaatggtcgctaccatcaaaggatat
cacctgatattgacaatgcctgagacgatgagtctggaacggcgtaacctgttgaaagca
ctcggtgcggaaatcgttctgacagacggcttgggcggaatggcggcttccattgcaaag
gctgaggaattgcgagacagtattcccggttcggtgattctgcaacaatttgagaatcca
gccaatgcggcggcgcatgagcgtacgacaggagaagaaatctggcgggatacagatggt
gaagtagacgtttttgttgccggagtcggcaccggaggaacggtttgcggtgtagcccgt
gctttaaagaaacataatcccgatatttatatcgtagcggtagaaccggctgcgtctcct
gtattggaaggtggacaggcggctccacaccgtattcagggaatcggagccaattttatt
cctaaactttatgatgcttctatgatagacgaagttatcggtgtgcctgatgatgaagcg
attcgtgcaggacgtgagctatcggcaacggaaggcttgttgaccggaatttcttcggga
gcagctgtgtatgcagcccgtcaactagcacagcgtccggaatttaaaaacaaaaagata
gtggcgttgttacctgatacgggagagcgttatttgtcaacggaattgtttgcatttgac
gcatatccgttggactga