Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|451515.3.peg.987 Oligopeptide transport ATP-binding protein OppD (TC 3.A.1.5.1) [Staphylococcus aureus subsp. aureus USA300_FPR3757]
atgaataatgtattgttagaggttaaagatttagaaacatcattaaaaataaataatgaa
tggttagcaactgttgaaaatatttcttttgaattatctaaaggagaagttttgggtata
gtaggggaatctggttgcggtaagtccatattaagtaagtcaattattaaattattacca
gaaaagatatctaaactaagtaatggagaagttatatttgatggtaaacgaatcgatacg
ctcaatgagaagcaattgccagatattcgaggaaatgatattgctatgatttttcaagaa
cctatgactgctttaaatcctgtatttaccataaaaaatcaacttgtggaatctataaaa
tcacataaaaaaatttctaaaaaagaagcaaataaattagcaaaagatttactaaaaaaa
gttggaattgctagacaagatgaaatattaaatagctatcctcatcaattatctggtggt
atgagacaaagagtaatgattgcaatggccatttcatgttctcctaaattattaattgct
gatgaacctacaacagcattggatgtcacgattcaagcgcaaatattagacttattaaaa
gaattgcaaaaggaaacgcaaatggcaattatgatgattacacatgatttgagtgtagtt
gctgagttttgcgataaagtcttagttatgtatgcaggtcaaattgtagaatttggaggc
ataaaagaaatactacacaatccgaaacatccttatacccaaaaattattatcaacaatt
ccaaaacttaaagaagagcagaaacgacttgaaacgatagaaggaattgtgccatcaatc
caagcatttcacgttaataagtgcagatttgcaaatagatgtaacaaaaaactggatatt
tgtaataatcaatctcctaaaatgcatgtttgtgaagatgtcattgtacgttgtcatttg
tacaaaaatgaatataaggagatataa