Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|451515.3.peg.923 Glyoxylate reductase (NADP+) (EC 1.1.1.79); Glyoxylate reductase (EC 1.1.1.26); Hydroxypyruvate reductase (EC 1.1.1.81) [Staphylococcus aureus subsp. aureus USA300_FPR3757]
ttggtaaaaatagttgtttcgaggaaaattccagataaattttatcaacaattaagtaaa
cttggtgacgttgttatgtggcaaaaatcattagtgcctatgcctaaagatcaatttgtg
acagcacttcgtgacgcagatgcttgttttattacattaagtgaacagatcgatgcagaa
attttagcgcaatcaccaaatttaaaagtaattgcgaatatggctgtaggatatgacaac
atcgatgttgaaagtgcaacagcgaataacgtggttgtcacgaatacaccaaatgtactt
actgaaacaactgcagaattaggatttacattaatgcttgctatagcacgccgtattgta
gaagctgaaaaatatgtagaagcagatgcatggcaaagctggggtccttatttattgtca
ggtaaagatgtcttcaattcaactattggaatatatggtatgggagatattggtaaagct
tttgcaagaaggttgcaagggtttaatactaatattctttatcataatcgatcaagacat
aaagatgcagaggcggactttaatgcaacatatgtttcttttgaaacgttgttagcagaa
agtgattttatcatctgtacagcgccacttacaaaagaaacacatcataaatttaatgct
gaagcatttgaacaaatgaaaaatgatgcaatttttattaatatcggtagaggacaaatt
gtagatgaaacagcattaatcgatgcactagacaataaagaaattttagcatgtggttta
gatgtattagcaaatgaaccgattgatcatacacatccattaatgggacgtgataatgtt
ctgattacaccacacattggtagcgcatcagtaacaacacgggacaatatgattcaatta
tgtattaataatatagaagcggttatgacaaatcaggtaccacatactccagtaaattga