Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|451515.3.peg.2163 Serine phosphatase RsbU, regulator of sigma subunit [Staphylococcus aureus subsp. aureus USA300_FPR3757]
gtggaagaatttaagcaacattataagggtttaattgatgaaagtttaacgtgccaagat
aaagtagaattgataaaaaagtgtgagaaatacactgacgaagtgattcgtaaggacgtc
ttgcctgaagacattgtcgatattcacaaaaactatatattgacgttaaacttaacgcgt
gaagatgtgttcaagacattagatgtcttacaagaaatcgttaaaggctttggttatagt
tatcgagattatcaaagattggtagataaacttcaagttcacgataaagagatagactta
gcttctagcttacaacaaacaatgcttaaaacagatattccacaatttgatagtattcaa
attggcgttatttcagtggcggcacaaaaagtaagtggagattattttaatttaattgac
cataacgatggcacaatgagctttgctgttgcagatgtcattggaaaaggtataccagct
gctttagcaatgagtatgataaagtttggcatggattcttatggacactcacaattaccg
agtgatggtttaaaacgtttaaatcgtgttgttgaaaagaatattaatcaaaatatgttc
gtcacaatgttttatggtttatatgaagaaatgaaccatttattgtattgtagttcagct
ggtcatgagcctggatatatttatcgcgctgaaaaagaagaatttgaagaaatttcagtt
agaggtagagtgttaggaatcagttcacaaacacgatatcaacaacaagaaattccaata
taccttgatgatttaattatcattttaacggatggtgtgactgaagctagaaatagtgaa
ggtacctttatagataaacaaaaacttttagaatatattaaaaaacataaacatatgcac
ccacaagatattgttcaaattatctatgaagcaattttaaagcttcaaaacccaaataaa
aaagatgatatgactattttgattataaaaagagtaaattaa