Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.889 Na(+) H(+) antiporter subunit F (TC 2.A.63.1.3) [Staphylococcus aureus subsp. aureus str. Newman]
ctgtattaggaggtaaataacatggctgtacaattagtattaaactttattatcgcagtg
ttttggttgtttgtgacaaatagttacacaacaaataactttgtgttaggtttcatcttt
ggcctagttcttgtttacctcttacacagagtgttaccaggtagattttatgtcatcacg
ctatatcgtattattaaattagttattattttcttaatcgaactgattaaagctaatttt
gatgttttgaaaattattattaaaccttcgattaaaaatgaaccaggattctttgtttat
cacacagatttaaaaaaagattggcaaattgtcttgctgtctaatttaattacattaaca
cctggtactgtagtgcttggtgtaagtgacgatcgtacaaaaatttatattcatgccata
gatttttcaactaaagagcaagaagtagaaagtattaaaacatcattagagaaaattgta
agagaggtgggcgaaatataATGAATCATAATGTTATTATCGTTATTGCATTAATCATAG
TTGTCATTTCTATGTTAGCTATGCTCATTCGCGTTGTGCTAGGCCCATCACTTGCCGATC
GTGTTGTCGCATTAGATGCGATTGGTCTTCAATTAATGGCAGTTATAGCATTATTCAGTA
TTTTATTAAATATTAAATACATGATTGTCGTTATTATGATGATTGGTATATTAGCTTTTT
TAGGTACTGCAGTATTCTCTAAATTTATGGACAAAGGTAAGGTGATTGAACATGATCAAA
ATCATACTGATTAGtcttgcacttatctttgttatcatcggtgctttaattagcgcccta
gcagctataggattattgagacttgaagatgtatattcacgtgcacatgctgccggaaaa
gcatcaacattaggtgcaatgtcattactatttggtacgtttttatattttattgctact
caaggttttgtaaatatgcaattaatcgttgcgattatctttgtattaattacaggtcct
ctttcaagtcatatgattatgaaagcagcatataatattaaaacgccttatactaaaaag
actaaagtcgatgaaatttcggaagacttaaaagacacaaaattgtagattatataacaa
aatcatgaatataaatcaacaacaaacagcagtaagatgattccaaattaggaatgattt
tactgctgttttcttttgacattgttacctctttttcaatgattttttctttgactacag
attcgccctatctacatatatctctttaatttaa