Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.1990 Lipid II isoglutaminyl synthase (glutamine-hydrolysing), GatD subunit (EC 6.3.5.13) [Staphylococcus aureus subsp. aureus str. Newman]
atgcatgaattgactatttatcattttatgtcagataaattgaatttatacagtgatata
ggaaatattattgctttaagacaacgtgctaaaaaacgaaatattaaagttaatgtcgta
gaaatcaatgaaacagaaggtattacctttgatgaatgtgatattttctttatcggtggt
ggaagtgatagagaacaagcattagcaacaaaagaattaagtaaaattaagacaccactt
aaagaagcgattgaagatggtatgccgggattaacgatttgtggaggctatcaattttta
gggaaaaaatatatcacgcctgatggtacagaattagaagggttaggtattttagatttt
tatactgaatcaaagacaaaccgattaacaggagatattgttatcgaaagtgatactttt
ggaactattgtaggttttgaaaatcacggtggtagaacatatcatgatttcggtacactt
ggtcatgttacttttggttatggtaataatgatgaagataaaaaagaaggcattcattat
aaaaatttattaggtacttatttacatggaccaattttacctaaaaattacgaaatcact
gattatctgttagaaaaagcttgtgaacgtaagggtattccgtttgagcctaaagaaata
gataatgaagcggaaatacaagcgaaacaagtattaatagacagagcaaatagacagaag
aaatctcgttaa