Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.1715 DNA polymerase I (EC 2.7.7.7) [Staphylococcus aureus subsp. aureus str. Newman]
catgaaaaaagagttcagttattaaaacaacaaattaaagatcatccacgacaagaggtt
tatacagtggaatcattgccgtttgaacattatatgcatcatccgtcaccaatcaataaa
aattaccaagagtggtttaataattatgaagaattaccgaaaatgaccaaagttaaatat
attccatttggttcagacgattcataacttattcttacctataaaaatttaaaatagcag
cataaaaatattaaaaagtagacataatcatgaaatgataatgtgcatctcaaaagttgg
acttttaacctgactttatggagtgctcatcaagaacaatcatgattatgtcttttttat
tttttagctaagtctatataggcacttgttttatttgaaattaggtcgtgtataaatact
ctatgagatagtttctttaattacgacatcacagtcgaatatgctaaaatatatataaat
tagttctggaggttaaaattGTGAATAAATTAGTATTAATCGATGGTAATAGCTTAAGTT
TTAGAGCTTTTTATGCATTACCTTTGTTATCAAACAAAGCAGGCATTCATACCAATGCAG
TATATGGTTTTGCAATGTTACTAGAGAAGATTTTAAAAGAAGAAAAGCCAAATCATTTTT
TAGTAGCGTTTGATGCAGGTAAAACGACTTTCAGACATGAAAAATATAGTGAATATAAAG
GTGGACGCCAGAAAACGCCGCCTGAACTAAGTGAGCAATTTCCTTATATTCGCCAATTAT
TAGATGCTTATCATATTAAACGTTATGAATTAGATAACTATGAGGCAGATGATATTATCG
GAACTTTAAGTAAAGAAGCAGATAAAGCGGGCTTTCAGACAATTATTATTACGGGAGACC
GAGATTTAACACAACTTGCAACGGATAATGTAACCATTTATTACACTAAAAAAGGTGTTA
CTGATGTTGATCATTATACACCTGACTTTATTGCGGAAAAATACAACGGGTTAACACCTA
ATCAAATTATTGATATGAAAGGATTAATGGGAGATACTTCTGATAATATACCAGGTGTTG
CAGGTGTTGGAGAGAAAACAGCAATAAAATTGCTAAACCAATTTGACACAGTAGAAGGTG
TCTATGAACATTTAGATGAAATTTCAGGTAAAAAGTTAAAAGAAAAACTTCAAAATAGCA
AAGAAGATGCATTAATGAGTAAAGAATTAGCAACGATTAATGTAGATAGTCCGATTGAAG
TAAAACTTGAAGATACGTTAATGACTCATCAAGATGAACAACAAGAAAAAATCGAATTGT
TTAAGAAGTTAGAATTCAAACAATTGTTGGCTGACATTGATCAATCAGCAAGCGTTGAAG
ATGCAATAGAAAAGACATTTGAAATTGAAACGTCTTTTGATAATATTGATTTTACTTCAT
TGAAAGAAGCGGCCATCCATTTCGAATTAGACGGTGGTAACTATTTGCGAAATAATATTT
TAAAATTCTCTTTATTTACAGGTGAGAAACATATTGTAATTAATGCGGATGACATAAATA
ATTATGTCGAACTAGTTTCATGGTTAGAAAATCCGAATTCGAAAAAAGTCGTATATGATG
CTAAAAAAACATATGTAGCATCACATAGATTGGGGATTGATATTCAAAATATTTCTTTCG
ATATTATGTTGGCCAGTTATATAATTGATCCATCTCGTACGATTAGTGATGTTCAATCAG
TTGTTTCATTGTACGGTCAAAGTTTTGTGAAAGACGATGTGAGTATATATGGAAAAGGTA
AGAAATTTAAGGTACCTGAAGATGATGTTTTAAATCCATATGTTGCTTCTATTACTGATG
CAATTTACTTTGCGAAACCAAATATGGATAAACAATTAGAAGAATACAATCAGGTAGAAC
TCTTGGCTGATTTAGAGCTACCGCTAGCTAAGATTTTAAGTGAAATGGAAGAAATTGGTA
TATTTACAGATGTTCATGATTTAGAAGAAATGGAAAAAGAAATTCAAGAAAAATTAGACG
TCTTGATTCGAAATATCCATGATGCAGCTGGTGAAGATTTTAATATAAATTCTCCTAAGC
AATTAGGTGTTGTATTGTTTGAGACATTACAATTACCTGTTATTAAAAAGACGAAAACAG
GATATTCTACTGCTGTAGATGTCTTAGAGCAATTGCAAGGTGAACATCCTATCATTGATT
ATATTTTAGAATATCGTCAATTATCTAAGTTACAGTCTACTTATGTTGAAGGATTGCAAA
AGGTAATTAGTGATGATCAACGTATCCATACACGTTTTAATCAAACTTTAGCGCAAACTG
GACGTTTATCAAGTGTAGATCCTAATTTACAAAATATTCCGGTTAGACTTGAAGAAGGGC
GTAAAATAAGAAAAGCCTTTAAACCAACTTCAAAAGATAGCGTTATATTATCAGCAGATT
ATTCTCAAATTGAATTGCGTGTATTAGCACACATTACACAAGATGAGAGTATGAAAGAAG
CATTTATCAACGGCGATGATATTCATACAGCAACTGCTATGAAAGTATTTGGTGTAGAAG
CTGATCAAGTCGATAGTTTAATGCGTCGTCAAGCAAAAGCAGTTAACTTTGGAATTGTTT
ATGGGATAAGTGATTATGGTTTAAGTCAAAGTTTAGGTATTACTCGTAAAAAAGCAAAAG
CATTCATTGATGATTATTTAGCTAGTTTCCCAGGTGTAAAACAATATATGTCTGATATTG
TAAAAGATGCCAAAGCTTTAGGTTACGTGGAAACATTGCTACATCGTCGACGCTATATTC
CTGATATTACGAGTCGTAACTTTAATTTACGCGGCTTTGCTGAACGTACTGCTATGAATA
CGCCAATACAGGGCAGTGCTGCAGATATCATTAAACTGGCAATGGTTAAATTTGCTCAAA
AAATGAAAGAGACAACATATCAAGCTAAACTATTATTACAAGTACACGATGAATTAATTT
TTGAAGTACCTAAGTCAGAAGTAGATTCATTTAGTGAATTTGTAGAAGAGATAATGGAAA
ATGCATTGCAATTAGATGTTCCATTAAAAGTAGACTCAAGTTATGGTGCAACCTGGTATG
ATGCAAAATAAagtgaggttaatggtatgcccgaattaccagaagtagaacatgtaaaaa
gaggaattgaaccctacgttataaatcaaaaaattgaacacgttatattttcggataaag
taatcgaaggtaaagctcaaggcaaggaaacaattataaaaggaattgaattagatactt
ttaaaactttatcggaaggctataccattacaaatgtagaacgaagaagtaaatatatcg
tttttcagctagataataaacgagaacaacgtacattaattagtcatttaggtatggcgg
gcggttttttcattgtagatgaacttgaagatattatgatacctaattatcgtaagcatt
ggcatgttatttttgagttgtcaaatgacaaaaagttaatttattcagatatacgtcgtt
ttggagaaattagaaatgttgcgtctgtagcatcttatccttcatttttagaaatagcgc
ctgaacctttttcaaatgaagcattgacgta