Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.1553 Octaprenyl diphosphate synthase (EC 2.5.1.90) / Dimethylallyltransferase (EC 2.5.1.1) / (2E,6E)-farnesyl diphosphate synthase (EC 2.5.1.10) / Geranylgeranyl pyrophosphate synthetase (EC 2.5.1.29) [Staphylococcus aureus subsp. aureus str. Newman]
atgacgaatctaccgatgaataaattaatagatgaagtcaataatgaattatcggttgcg
ataaataaatcagtaatggatactcagctagaagaaagtatgttgtattcattaaatgct
ggaggtaaacgcatccgaccagttctgttattactcactttagattcactaaataccgag
tatgagttaggtatgaagagcgcaattgcactagaaatgattcatacatattcacttatt
catgatgacctaccagcgatggataatgatgattatcgacgaggaaaattaacaaatcat
aaagtatatggtgagtggactgcgatattagcaggtgatgctttattaactaaagcattt
gaacttatttcaagtgatgatagattaactgatgaagtaaaaataaaagttctacaacgg
ctgtcaatagcaagtggtcatgttggaatggtcggcggtcaaatgttagatatgcaaagc
gaaggccaaccaattgatcttgaaactttggaaatgatacacaaaacaaaaacaggagca
ttattaacttttgcggttatgagtgcagcagatatcgctaatgtcgatgatacaactaaa
gaacatttagaaagttatagttatcatttaggtatgatgttccagattaaagatgattta
ttagactgctatggtgatgaagcaaagttaggtaaaaaagtgggcagcgatcttgaaaat
aataaaagtacgtacgtgagtttattagggaaagatggcgcagaagataaattgacttat
catagagacgcagcagtggatgaactaacgcaaattgatgaacaattcaatacaaaacac
ttattagaaatcgttgatttattttatagcagggatcactaa