Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.1423 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase (EC 2.3.1.89) [Staphylococcus aureus subsp. aureus str. Newman]
atggtacaacatttaacagctgaagaaattattcaatatataagtgatgctaaaaagtct
acaccaataaaagtatatttaaatggtaattttgaaggcatcacatatccagaaagtttt
aaagtatttggttcagaacaatctaaagtaatcttttgtgaagcggatgattggaaacct
ttttacgaagcatatggtagtcaattcgaagatatagaaattgaaatggatcgtcgcaat
tctgctattccattaaaagacttaacaaatacgaatgcacgaattgaaccaggtgcgttt
attagagaacaagccattattgaagatggtgctgtcgttatgatgggcgcaacaattaat
attggcgcagtcgttggcgaaggtacaatgattgatatgaatgctactctcggtggtcgt
gctacaactggtaaaaatgtacatgtaggggctggcgcagtattagcaggtgtgattgaa
ccccctagtgcttcaccggttataatcgaggatgatgtattaatcggtgcaaatgcagtt
attttagaaggtgtacgtgttggtaaaggtgctattgttgcagctggcgcgattgtgaca
caagatgtaccagctggtgcagttgttgctggtacaccctgcaaagtgattaaagcagct
tctgaagtacaagatactaaaaaagagattgtagcagcattaagaaaactgaatgactag