Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|426430.8.peg.1144 Heme-degrading monooxygenase, staphylobilin-producing (EC 1.14.99.48) # IsdG [Staphylococcus aureus subsp. aureus str. Newman]
cagtactacaaggtaagacaaatcacgattatttaaatttagattttgagcgagaacatc
gacgtaaaggtagtatttttatggattttagaaatgaattgaagaatttaaatcataata
ctattttatacgggcaccatgtcggtgataatacgatgtttgatgtgttagaagattatt
taaagcaatcgttttatgaaaaacacaagataattgaatttgacaataaatatggtaaat
atcaattgcaagtatttagtgcatataaaactactactaaagataattacatacgtacag
attttgaaaatgatcaagattatcaacaatttttagatgagacaaaacgtaaatctgtaa
ttaattcagatgttaatgtaacggtaaaagatagaataatgactttatcaacgtgcgaag
atgcatatagtgaaacgacgaaaagaattgttgttgtcgcaaaaataattaaggtaagtt
aaacagaaaagaggataattATGAAATTTATGGCAGAAAATAGGCTGACGTTAACAAAAG
GAACAGCAAAAGATATTATAGAACGATTTTACACGAGACATGGGATTGAAACATTAGAAG
GCTTTGATGGCATGTTTGTTACACAAACTTTAGAACAAGAAGATTTTGATGAAGTGAAAA
TTTTAACAGTTTGGAAATCAAAGCAAGCTTTTACGGATTGGTTAAAATCTGATGTCTTTA
AAGCAGCGCATAAACATGTTAGAAGTAAAAATGAAGATGAAAGTAGCCCGATTATAAATA
ACAAAGTAATTACATATGATATAGGCTATAGTTACATGAAATAAttgaatttaaagaggt
tgcagtacttgttatgacaattggtattgttagcttttgtaacgaccatacatgataccg
atgatggtcgtttttttaatgaacacaaacatgctaacaacaaattgctaaaacatagtt
tgatttgaatgtgctttgaaaataatcatcaattatatcattttgatttattttgaagaa
gaaaagaattaataatgatattttggggcgtatgatttatagtagtagtatcgataaaag
aaatttatacaatttgaaatattatgagtgataaaagcgattaattaatattaactatac
aatcaaatgttttcatcttattaatgattaatatttttatttttaaaaataaagcgagga
gctatcaatggaacaaattacttctgcacaaaataatagaattaaacaagcgaacaagct
aaaaaagaaacgtgagagggataaaactggattagctttaattgaaggtgtgcatttaat
tgaa