Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|348780.3.peg.592 Threonine dehydratase, catabolic (EC 4.3.1.19) @ L-serine dehydratase, (PLP)-dependent (EC 4.3.1.17) [Natronomonas pharaonis DSM 2160]
atgctcgaactcgccgacgtgaccgcggcgcgaccccgtgtggcggagacggcccgacag
acgccgctggaacactcgacgacgttctcgaagcgcaccggtgctgacgtgcggctgaaa
ctggagaacttccagcggaccgggtcgttcaagattcgcggcgcgacgaacaaggtcgcg
ttgctcgaagcggccgaccgcgaagccggcgtcgtcgctgccagcgccggcaaccacgcc
caaggtgtcgcgctggcggcctcgaaggcgggcgtcgacgccgtcatcgtgatgcccgaa
cacgcgccgatatcgaaaatcaacgccacgcgctcctacggcgcggaggtgcggctccac
ggcatcgactacgacgccgccgccgaacgcgcacacgaaatcgaacgcgaagagggtcgg
acgttcgttcacgcctttgacgacccggcagtgatggccggacagggaactatcggcctc
gaaatcgtcgagcagtgccccgacgtcgagaccgtcgtcgtccctatcggcggcggcgga
ctcatcgcgggggtagcgacagcggtcaaagaacagaccgacgcccgcgtcgtcggcgtg
caggccgaaggcgcggcaagcgccgccgactccctcgaaaagggcgaggtcgtcgagcgg
gacgcggtcgacaccatcgcggacggcatcgcgacccggaaggtcggcgaccgcaccttc
gatgtcatcgccgagcgggtcgacgaggtcgttacggtctccgatgacgaaatcgcccac
gcgttgacggctctgttagagcggtccaagacgctcgtcgagggggcgggcgcagtaccg
ctggcagcaatcctagagcggcgcttcgactatgcggacgacgagaccatcgttcccgcg
ctgtgtggcggtaacatcgacctcaacgtgctaacgacagtgattacccgcgggctcgtc
gaacgcggccggttcctgcgtatcaagaccgtgctgaaagaccgtcccggtgcgctacag
gagcttgtggggttgctcgtcgaccaccggacaaacatctacgccatcgaacacgaccgc
gcctcgaaagacattgccatgaacgccgcggaggtcgaactcgacctcgaaacgcggggc
cacgaccacgtcgtagagctgctcgacgcgctggaagacgccggctacgcggtcgaagtg
ctggtctga