Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|320842.3.peg.79 Phage phi 11 orf47 protein homolog [Bacteriophage 96]
atgatgaagatgatttatccaacttttaaagacattaaaactttttatgtgtggggttgc
tataaaaatgagcaaattaagtggtacgtagacatgggtgtaatcgacaaagaagaatat
gcattgatcactggtgaaaaatatccagaggcaaaagatgaaaagtcacaggtgtaa