Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|316401.4.peg.87 Acetolactate synthase small subunit (EC 2.2.1.6) [Escherichia coli ETEC H10407]
atgtttgctgcactttattatccattcgacaaaccgcgtcgctggatcaattccggtggc
ctcggcacgatgggttttggtttacctgcggcactgggcgtcaaaatggcgttgccagaa
gaaaccgtggtttgcgtcactggcgacggcagtattcagatgaacatccaggaactgtct
accgcgttgcaatacgagttgcccgtactggtggtgaatctcaataaccgctatctgggg
atggtgaagcagtggcaggacatgatctattccggccgtcattcacaatcttatatgcaa
tcgctacccgatttcgtccgtctggcggaagcctatgggcatgtcgggatccagatttct
catccgcatgagctggaaagcaaacttagcgaggcgctggaacaggtgcgcaataatcgc
ctggtgtttgttgatgttaccgtcgatggcagcgagcacgtctacccgatgcagattcgc
gggggcggaatggatgaaatGTGGTTAAGCAAAACGGAGAGAACCTGATTATGCGCCGGA
TATTATCAGTCTTACTCGAAAATGAATCAGGCGCGTTATCCCGCGTGATTGGCCTTTTTT
CCCAGCGTGGCTACAACATTGAAAGCCTGACCGTTGCGCCAACCGACGATCCGACATTAT
CGCGTATGACCATCCAGACCGTGGGCGATGAAAAAGTACTTGAGCAGATCGAAAAGCAAT
TACACAAACTGGTCGATGTCTTGCGCGTGAGTGAGTTGGGGCAGGGCGCGCATGTTGAGC
GGGAAATCATGCTGGTGAAAATTCAGGCCAGCGGTTACGGGCGTGACGAAGTGAAACGTA
ATACGGAAATATTCCGTGGGCAAATTATCGATGTCACACCCTCGCTTTATACCGTTCAAT
TAGCAGGCACCAGCGGTAAGCTTGATGCATTTTTAGCATCGATTCGCGATGTGGCGAAAA
TTGTGGAGGTTGCTCGCTCTGGTGTGGTCGGACTTTCGCGCGGCGATAAAATAATGCGTT
GAgaatgatctcaatgcgcaatttacagcccaacatgtcacgttgggctttttttgcgaa
atcagtgggaacctggaataaaagcagttgccgcagttaattttctgcgcttagatgtta
atgaatttaacccataccagtacaatggctatggtttttacattttacgcaaggggcaat
tgtgaaactggatgaaatcgctcggctggcgggagtgtcgcggaccactgcaagctatgt
tattaacggcaaagcgaagcaataccgtgtgagcgacaaaaccgttgaaaaagtcatggc
tgtggtgcgtgagcacaattaccacccgaacgccgtggcagctgggcttcgtgctggacg
cacacgttctattggtcttgtgatccccgatctggagaacaccagctatacccgcatcgc
taactatcttgaacgccaggcgcggcaacggggttatcaactgctgattgcctgctcaga
agatcagccagacaacgaaatg