Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|273036.6.peg.267 FIG01108223: hypothetical protein [Staphylococcus aureus RF122]
aaaaattatcgaatatatattgattcctaatgtcgtagaatccaagtttataattattgt
aagcatgttggttatcgctggagcacaatttgtggcatttcaatttattatgcaatacag
tagattctatatttttgaattaaacacagaagaagatgactaaataattttataaattct
gtggagtatacttatataagaaaatcaacttcaacgtatatcaccatattattttatact
caatgatgtgaatgaatttaagtggattgatattaaagtaaaagttatggaatattgagg
tgcgaatatggagttcttattattaattgtcgtagccggactgtattatattatatattt
aactgctgtgatgtattctgaaaaaatagtagtattgcctataatcatctatgccattgt
gtttgtagtaattggtatcacttatattttttataggtgacagctatgatcagttaacaa
atttcaatgtgattttgtatATGGGGAGTTTGTTTTATGCATGGATGGCTTTTAGAAATA
TTTGGAACAGACCACTATTACTAAAATATAAGAACATTACAGATAGTTCAAGTGGAATAG
TTAATAAATCTGAATACAATGCAGTTGAAAGCTTACGTATAAACATTGAAATAGCTAAGT
ATAAAGGGATTATTTCTTTGATAGTAGCTATAGTATTAACGGTATTAATGACATTAAAAT
CAACACCTCAAATTACTGCAGAAACACGTGACTTAAGTATCTCATTTTTCATACTCAGCT
TATTTATCATTATAATATTTGCAGTTTGGGATTTGATTATTAGAGTTAGAAAGGGAACGT
TTGCTTTTGTTGTAATAAGGCCAATATTATTTAGTTGTTGGTTATTTATTTTGAATATGA
TTTTATCAAGATTATTATAAttataagaagttgaataaattgtaaagtgaaaaatcattg
agaatttcaattattgtaacaataatttcttttgctttagatttattagcatatttaggt
ttaaaatgagtaatattattttgaagaagcattaagcgacgtagaggtgttgttttaatg
ctttttatttaacagtaatgaaatcaatatctattttgaaaatataggggcgataacatg
actttcgaagagaaattaagtgaaatgtataacgagattgcgaatgagattagtgggatg
atacctgtagagtggggaaaggtatatgcaatggcatatatagatgatgaaggaggcgaa
gtgttctactattacacagaacctggaagcaatgaattatactactatactagtgtatta
aataaatatgatatatcggaatcagaatttatggactcagagtatgagttgtataaacaa
tttcaaaagttaagaaatatatttaaaaaagaaggacatg