Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.903 Oligopeptide transport ATP-binding protein OppD (TC 3.A.1.5.1) [Staphylococcus aureus subsp. aureus N315]
gcagagttgtacgtggagaatttttaaaattgaaaaatcaagagtttgtcatggcttcga
aaacattgggggcttcaaaattcaaattgatatttaagcatattttacctaatacgttag
gtgctatcgtggttacatcaatgtttacagtacctagtgctattttcttcgaagcatttt
taagtttcattggtataggtgtacctgcacctcaaacatcgttagggtcattagtaaatg
atgggcgcgcaatgttattaatttatccacatgaattatttataccagcaatgattttaa
gtttattaattctattcttttacttatttagtgatggattacgtgatgcatttgatccga
aaatgcgtaaataaaagggggcatagcatatgactgaaagaatattagaagtaaatgatt
tgcatgtttcctttgatattacagcaggggaagtgcaggcagtgagaggtgtagattttt
atttaaacaagggggaaacaTTGGCAATTGTTGGTGAATCAGGTTCAGGTAAATCTGTAA
CAACAAAAGCAATTACAAAATTATTCCAAGGGGACACAGGAAGAATTAAAAAGGGAGAAA
TTTTATTTTTAGGGGAAGATTTAGCAAAAAAACCTGAAAATGAGTTAATTAAATTACGTG
GCAAAGATATTTCAATGATCTTTCAAGATCCAATGACATCTTTAAACCCAACGATGCAAA
TTGGTAAACAAGTCATGGAACCATTAATTAAGCACAAAAATTATAGTAAAGCACAAGCTA
AAAAGCGCGCATTGGAAATACTAAATCTTGTAGGTTTACCAAATGCAGAAAAAAGATTTA
AAGCATATCCTCATCAATTTTCAGGTGGACAAAGGCAAAGAATTGTTATTGCAACCGCAT
TAGCTTGTGAACCTAAAGTGCTCATTGCTGATGAACCAACGACTGCATTAGACGTAACGA
TGCAGGCACAAATTTTAGATTTAATGAAAGAACTACAACAAAAAATCGATACAGCAATTA
TTTTTATAACGCATGATTTAGGGGTTGTTGCGAATATTGCTGATAGAGTGGCAGTTATGT
ATGGTGGTCAAATGGTTGAAACAGGAGATGTTAACGAAATATTTTATGATCCAAAGCATC
CATATACATGGGGATTATTATCGTCAATGCCTGATTTATCAACAACAAATGACACACCAT
TACTAGCGATTCCTGGAGCGCCACCTGATTTATTACACCCACCTAAAGGTGATGCATTTG
CGAGACGTAGTCAATATGCATTAGATATTGATTTTAAAGTAGAACCACCGTGGTTTAAAG
TTTCACCGACACATTTTGTGAAATCTTGGTTATTAGACGCACGTGCACCAAAAGTTGAAC
TACCCGAGCTGGTAAAACAACGTATGAAACCGATGCCTAATAATTATGAAAAACCACTCA
AGGTAGAAAGGGTGTCGTTCAATGAAAAATGAtgaagtgctattatctattaaaaattta
aagcaatattttaacgcaggaaagaaaaacgaagtgagagcgattgaaaatatttcgttt
gatatatacaaaggggaaacattaggtttagtaggagaatcggggtgtggtaaatctaca
actggtaaatcaattattaaacttaatgatattacaagtggagaaattttgtatgagggt
attgatatacaaaagattcgtaaacgtaaagatttgcttaaatttaataaaaagatacag
atgatttttcaagacccatatgcgtctttaaatcctaggttaaaagtaatggatatagta
gctgaaggtattgatatccatcatttagcaactgataagcgtgaccgaaaaaaacgtgtc
tatgatttacttgaaactgttggattaagtaaagaacatgccaatcgctatcctcatgaa
ttttcaggtggacaacgccaacgtattggaattgcccgtgcattagccgttg