Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.6 DNA gyrase subunit A (EC 5.6.2.2) [Staphylococcus aureus subsp. aureus N315]
atggctgaattacctcaatcaagaataaatgaacgaaatattaccagtgaaatgcgtgaa
tcatttttagattatgcgatgagtgttatcgttgctcgtgcattgccagatgttcgtgac
ggtttaaaaccagtacatcgtcgtatactatatggattaaatgaacaaggtatgacaccg
gataaatcatataaaaaatcagcacgtatcgttggtgacgtaatgggtaaatatcaccct
catggtgactcatctatttatgaagcaatggtacgtatggctcaagatttcagttatcgt
tatccgcttgttgatggccaaggtaactttggttcaatggatggagatggcgcagcagca
atgcgttatactgaagcgcgtatgactaaaatcacacttgaactgttacgtgatattaat
aaagatacaatagattttatcgataactatgatggtaatgaaagagagccgtcagtctta
cctgctcgattccctaacttgttagccaatggagcatcaggtatagcggtaggtatggca
acgaatattccaccacataacttaacagaattaatcaatggtgtacttagcttaagtaag
aaccctgatatttcaattgctgagttaatggaggatattgaaggtcctgatttcccaact
gctggacttattttaggtaagagtggtattagacgtgcatatgaaacaggtcgtggttca
attcaaatgcgttctcgtgcagttattgaagaacgtggaggcggacgtcaacgtattgtt
gtcactgaaattcctttccaagtgaataaggctcgtatgattgaaaaaattgcagagctc
gttcgtgacaagaaaattgacggtatcactgatttacgtgatgaaacaagtttacgtact
ggtgtgcgtgtcgttattgatgtgcgtaaggatgcaaatgctagtgtcattttaaataac
ttatacaaacaaacacctcttcaaacatcatttggtgtgaatatgattgcacttgtaaat
ggtagaccgaagcttattaatttaaaagaagcgttggtacattatttagagcatcaaaag
acagttgttagaagacgtacgcaatacaacttacgtaaagctaaagatcgtgcccacatt
ttagaaggattacgtatcgcacttgaccatatcgatgaaattatttcaacgattcgtgag
tcagatacagataaagttgcaatggaaagcttgcaacaacgcttcaaactttctgaaaaa
caagctcaagctattttagacatgcgtttaagacgtctaacaggtttagagagagacaaa
attgaagctgaatataatgagttattaaattatattagtgaattagaaacaatcttagct
gatgaagaagtattactacaattagttagagatgaattaacagaaattcgagatcgtttc
ggtgatgatcgtcgtactgaaatccaattaggtggatttgaagatttagaagatgaagat
ctcattccagaagaacaaattgtaattacactaagccataataactacattaaacgtttg
ccggtatctacatatcgtgctcaaaaccgtggtggtcgtggtgttcaaggtatgaataca
ttggaagaagattttgtcagtcaattggtaactttaagtacacatgaccatgtattgttc
tttactaacaaaggtcgtgtatacaaacttaaaggttatgaagtgcctgagttatcaaga
cagtctaaaggtattcctgtagtgaatgctattgaacttgaaaatgatgaagtcattagt
acaatgattgctgttaaagaccttgaaagtgaagacaacttcttagtgtttgcaactaaa
cgtggtgtcgttaaacgttcagcattaagtaacttctcaagaataaatagaaatggtaag
attgcgatttcgttcagagaagatgatgagttaattgcagttcgcttaacaagtggtcaa
gaagatatcttgattggtacatcacatgcatcattaattcgattccctgaatcaacatta
cgtcctttaggccgtacagcaacgggtgtgaaaggtattacacttcgtgaaggtgacgaa
gttgtagggcttgatgtagctcatgcaaacagtgttgatgaagtattagtagttactgaa
aatggttatggtaaacgtacgccagttaatgactatcgtttatcaaatcgtggtggtaaa
ggtattaaaacagctacgattactgagcgtaatggtaatgttgtatgtatcactacagta
actggtgaagaagatttaatgattgttactaatgcaggtgtcattattcgactagatgtt
gcagatatttctcaaaatggtcgtgcagcacaaggtgttcgcttaattcgcttaggtgat
gatcaatttgtttcaacggttgctaaagtaaaagaagatgcagaagatgaaacgaatgaa
gatgagcaatctacttcaactgtatctgaagatggtactgaacaacaacgtgaagcggtt
gtaaatgatgaaacaccaggaaatgcaattcatactgaagtgattgattcagaagaaaat
gatgaagatggacgtattgaagtaagacaagatttcatggatcgtgttgaagaagatata
caacaatcatcagatgaagatgaagaataa