Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2658 Tyrosine-protein kinase EpsD (EC 2.7.10.2) [Staphylococcus aureus subsp. aureus N315]
atgacgaatacacgaagaagtacatcaagtttaattgtccatgaacaaccaaagtcacct
attagcgagaaatttcgaggcataagatcaaatattatgtttgcaaatcctgacagtgca
gttcaaagcattgtaatcacttcagaggcaccaggcgcaggtaagtctacaattgcagca
aatttagcagttgcatatgcgcaagcaggttataaaacactaatcgtagacggggatatg
cgtaaacctacgcagcattatatttttaatttgccaaacaatgaaggcctatcaagttta
ttgctaaattggtcaacttatcaagacagtattatctcaactgaaattcaagatttagac
gtcttgacgtctgggccaatcccaccgaatccgtcagagttaattacatcaagggcattt
gcaaatttgtatgacacattattgatgaattataactttgtcattatcgatacgccacca
gtgaacacagttacagatgcgcaattattttcaaagtttaccggcaatgttgtctacgta
gttaattcggaaaataataataaagatgaagttaaaaaaggaaaagaacttattgaagca
acaggtgctaaattattaggtgtagtcttaaatagaatgcctaaagataaaagtgctagt
tactatgcatattatgggactgatgaatcatga