Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2640 Isochorismatase (EC 3.3.2.1) [Staphylococcus aureus subsp. aureus N315]
atgtctcgaaaaacggcgctattagttttggatatgcaagaaggtatagcgagtagtgta
cctagaataaaaaatattattaaagcgaatcagagagcaattgaagcagcaagacaacat
cgaataccagtcattttcatacgtttagtgttagataagcattttaatgatgtctcctcg
agtaataaagtgttttcaacaattaaagctcaaggatatgcgattactgaagcagatgca
tctacacgaatacttgaagatttagcaccactagaagatgagccgattatttctaagcga
cgctttagcgcatttacaggtagttacttggaagtttatttacgtgcaaatgatattaat
catttagtattaacgggtgtctctacgagtggagctgtattgagcacggcattagaaagt
gtagataaagactattatattactgttttagaagatgctgttggtgatagatcagatgat
aaacatgactttattattgaacaaattttatcacgctcatgtgacattgaatccgtagag
tcatggaaaagtagtttatag