Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2500 Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11) [Staphylococcus aureus subsp. aureus N315]
atgactcaaattactgaaaaagaattaaaaaagaagtatttagatttactatcccaaaat
tttgatactccagaaaaacttgcaactgaaattatcaatttagaatcaattttagaatta
cctaaaggtacggaacatttcgtcagcgatttacatggtgaatacgaagctttccaacac
gtattacgcaacggttctgggaatgtgcgagcgaaaatcaatgatattttcaaagagaga
ctttcaactaaggagcttaatgatttaactgctcttgtctactatccagaagacaaatta
aaattgattaaaagtgatttccaaagttgcggtcaacttaatgtctggtatatcacaaca
atcgaacatttaattgagttgattaaatattgttcttcaaaatatacgcgttcaaaactg
cgtaaagcattgccaaaacaatacgtttatattattgaggaactactgtataaaagtaat
gaatatcaaaataaaaaatcatattacgaaacacttgttaaccaagtaattgaacttaaa
caggcagatgatttaattattggactcgcttattccgtacaacgcttagtcgtcgatcat
ttacacgttgtcggtgatatttatgatcgtggaccacaaccagataaaattatggataca
ctgattaattatcattccctagatattcaatggggtaatcatgatgtgctttgggttgga
gcctatgctgggtcaaaagtatgcttagcaaacttacttcgaatttgtgcacgctatgat
aatttagatattatcgaagacgcttatggcattaatttaagaccactgcttactttagct
gaaaaatactatgacgcagataatcctgcttttaagcctaaaaaaagacctgacaaacac
gaacgtttaactcaacgtgaagaaagtcaaattactaaaattcatcaagctattgcgatg
attcaattcaagttagaaataccaattattaaacgtcgtccaaatttcgaaatggaagaa
cgtcttgtgcttgaaaaggttaattatgatacaaatgaaattacagtttatggtaataca
tacccgttgaaagacacatgtttccaaactatcaatcgtaataatccagcagaattacta
cctgaagaagaagaagtcatgaataaactattattgtcattccaacaatctgaaaaatta
cgtcgtcatatgtctttcttgatgcgtaaaggttcgctttacttaccatataatggtaat
ttactcattcatggttgtattccagttgatgaaaatggtgagatggaatcatttgaaatt
gatggtcatacttacagcggccaagaattattagatgtgtttgagtatcatgtccgtaaa
tcatttgatgaaaaagaaaatactgatgacttatcgacggatttagtttggtatttatgg
actgggaaatattcgtcattatttggtaaacgcgcgatgactacgtttgagcgatatttt
attgcagataaagcttctcataaagaagaaaaaaatccatactatcatttacgtgaagat
gtgaatatggttcgtaaaatgctcagtgatttcggattaaatccagatgaaggacgcatt
attaatggtcacacaccagtgaaagaaatcaatggcgaagatcctatcaaggctgatgga
aagatgcttgtcattgatggtggtttttcaaaagcttatcagtcaacaactggcattgca
ggctatacattgttgtataattcattcggaatgcaactcgttgcacaccaacaatttaac
gctaaagaaaaaatactttccgaaggtatcgatgaactttctataaagcgcgttgtagac
aaagaattacaacgtaagaagattcgtgataccaatattggtaaagagcttcaagctcaa
atagatattttgaaaatgttaatgcatgatcgttacttagactaa