Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2286 Sialic acid utilization regulator, RpiR family [Staphylococcus aureus subsp. aureus N315]
atgtcaaacgtactaacagaaatagatagtcaatatccatatatgactaaaaatgaaaaa
aagatagctaaatttatactaaattcacctcaaaaggtgattaaaatgaggtctcaagac
ttagcaagcttattagatattagtacatcatcagtcattcgattcagcaagaaaattact
gatggcggttttcacgacttgaaaataaatatatctaaatatgttcctaaagcatcatca
atttacaatgttgaattaatgaataacgaaagcacagaatctttaagaactaaactccat
acacgtactacacgcgcacttaatcatgcaaataacgaattaaatgataaaactattgat
caaatatgtcattgtttaaaacgttctgagacgatttttatatatggttttggcgcatct
tttgtagttgctaccgacttataccaaaagttatcaagaataggtcttaatattcaactt
gttcaagaaacacatatttttgctacattattagcaactcacaattcgaacgacagtgtt
attcttattactaacaatggtacgcaaagtgaaatgcaatcaatggttaaagttattgat
gactaccatatacctataattacaattactagtacaagggataatcccgtagcacaggca
tcaaatattgttttaacttatgggaaaactgatgaaaatgagatgcatatgggagcaaca
acttcattatttgctcaaatgttcactattgatattttatattatcgttatgttgcatta
aattatcacgcatcattagatttcataacacaatctaaaatggctttagataactatcgt
aaacatttatcaaatattaactttaaacattaa