Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2173 Retron-type RNA-directed DNA polymerase (EC 2.7.7.49) [Staphylococcus aureus subsp. aureus N315]
atggagaaaattgagaatgaaatagttaataagacatatcttgcaattaattctttggaa
gaattaagaaatatgattggtattaaatcagactatttttataaatgtctttatgtgaat
gaccatttttataatgttatcaaaatacctaaacgaaaaaaagatgaatatagagaattg
atgattcctaatatggctctcaaaaatatccaaaggtggattttagataatgtattgtac
agaaggcaagttcataaatgtgcaactggttttgttcctaggaaatcaatagtgaacaat
gcaatcccacacgttgggcagaaatatatattgaaaatggatatagaaaacttttttccg
agtatcacatttaagcaggttagaaaaatattttctgagatgggctataaatttgaactt
gcgacagcactcgcaaatttgtgtacagtgaataatcagttgcctcaaggtgcaccaacc
agtccatatatagctaatatcatcttttacaatatagataaaagaatcttttcttattgt
caaaaaaataatttgagatatactcgatatgctgatgatattactatttctggatctaat
aaagtaagttttagtaaagaaattatcagggaaatagtaaaccaatataattttagaatt
aatgaaagtaagacaattatgtttaaaccaggagacagaaaaaaagttactggtattata
gttaatgaaaaaatatcggttcctaaaactttaataagagaggtcaggaagcaaatttat
tttgtaaataagtttggattagaagaacacttaattcgaaataattattcattggattat
gagcagcaatttattatgagtatatatggaaaaatcagttttattaaaatgattgatttc
aagaaaggcgttagtttacaaaagaaatttaatgaagtactaggtaatatagaatcgtct
aacatgtacagagataatattgactttgatgatatagaactacattggataaattaa