Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.2057 3-hydroxyacyl-[acyl-carrier-protein] dehydratase, FabZ form (EC 4.2.1.59) [Staphylococcus aureus subsp. aureus N315]
atggaaacaatttttgattataaccaaattaaacaaattatacctcacagacagccattt
ttattaattgataaagtagttgaatatgaagaaggtcaacgttgtgtggctattaaacaa
gtatcaggaaacgaaccattctttcaagggcattttcctgagtatgcggtaatgccaggc
gtattaattactgaagcgttagctcaaacaggtgcggtagctattttaaatagtgaagaa
aataaaggtaaaatcgctttatttgctggtattgataaatgtcgttttaaacgtcaagta
gtacctggtgatactttaacgttggaagtagaaatcactaaaattaaaggaccaatcggt
aaaggtaatgctaaagctactgtcgatggtcaacttgcttgtagttgtgaacttacattt
gcaattcaagatgtaaaataa