Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.1712 Diaminohydroxyphosphoribosylaminopyrimidine deaminase (EC 3.5.4.26) / 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193) [Staphylococcus aureus subsp. aureus N315]
ttgagtcaatttatggattatgcgattcaacttgcaaatatggtacaaggtcaaacaggt
gttaatccacccgttggcgctgttgtagttaatgaaggtaggattgttggtattggtgca
cacttgagaaaaggtgacaagcatgcggaggttcaagcacttgatatggcacaacaaaat
gctgaaggtgcgacgatttatattacgttagagccatgtagtcattttggttcaacacca
ccctgtgttaacaaaattattgattgtaagatagcaaaagtagtatacgcaacaaaagac
aattcgttagacacacatggtgatgagacgttacgggctcacggtattgaggttgaatgc
gttgatgatgaacgggcatcacaattataccaagacttttttaaagcaaaagcaaagcaa
ctgccacaaattacagtgaaagtatctgcaagtttagatggtaaacaagcgaatgataat
ggacaaagtcaatggattactaacaaagaggttaaacaagatgtctataagttaagacat
cgacacgacgcagtgttaactggaagacgtacagttgaattagatgatccacaatatact
acacgtattcaagatggaaaaaaccctataaaagtaatattgtctaagtctgggaatatt
cattttaatcagcaaatttatcaagatgaatcaacaccaatttggatatatactgaaaat
ccaaatttaacaagcaatcaaacacatattgaaattatttacttgaagtcttgtgattta
acaacaattcttcacaatttatataaaagaggagttggaactttgctagtcgaggcaggt
ccaaccactacttcagaatttctccaatctaattatatagatgaatttattctctattat
gccccgaaattaattggcggatctggaaattatcaattttatcaaacaaatgatgtgatt
gagataccagatgcgaaccaatttgaaattgttcattccgagttattaaatcaaaatgtt
aaattaactttacgaaagaagtga