Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158879.11.peg.126 2,3-butanediol dehydrogenase, S-alcohol forming, (R)-acetoin-specific (EC 1.1.1.4) @ Diacetyl reductase [(S)-acetoin forming] (EC 1.1.1.304) [Staphylococcus aureus subsp. aureus N315]
atgacaaacaacaaagtagcattagtaactggcggagcacaagggattggttttaaaatt
gcagaacgtttagtggaagatggtttcaaagtagcagttgttgatttcaatgaagaaggg
gcaaaagcagctgcacttaaattatcaagtgatggtacaaaagctattgctatcaaagca
gatgtatcaaaccgtgatgatgtatttaacgcagtaagacaaactgccgcgcaatttggc
gatttccatgtcatggttaacaatgccggccttggaccaacaacaccaatcgatacaatt
actgaagaacagtttaaaacagtatatggcgtgaacgttgcaggtgtgctatggggtatt
caagccgcacatgaacaatttaaaaaattcaatcatggcggtaaaattatcaatgcaaca
tctcaagcaggcgttgagggtaacccaggcttgtctttatattgcagtacaaaattcgca
gtgcgaggtttaacacaagtagccgcacaagatttagcgtctgaaggtattactgtgaat
gcattcgcacctggtatcgttcaaacaccaatgatggaaagtatcgcagtggcaacagcc
gaagaagcaggtaaacctgaagcatggggttgggaacaatttacaagtcagattgctttg
ggcagagtttctcaaccagaagatgtttcaaatgtagtgagcttcttagctggtaaagac
tctgattacattactggacaaacaattattgtagatggtggtatgagattccgttaa