Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|158878.14.peg.2433 putative esterase [Staphylococcus aureus subsp. aureus Mu50]
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcatta
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgatactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggacatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagataatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggacgccttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaaatgggcgaatggcctaccatta
acagataagcgcatatcgccaattaatggcacaatagaaggattgccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctattcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaataactaa