Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.3550 2-ketobutyrate formate-lyase (EC 2.3.1.-) / Pyruvate formate-lyase (EC 2.3.1.54) [Escherichia coli P0299917.4]
atgaaggtagatattgataccagcgataagctgtacgccgacgcatggcttggctttaaa
ggtacggactggaaaaacgaaattaatgtccgcgattttattcaacataactatacaccg
tatgaaggcgatgaatctttcctcgccgaagcgacgcctgccaccacggaattgtgggaa
aaagtaatggaaggcatccgtatcgaaaatgcaacccacgcgccggttgatttcgatacc
aatattgccaccacaattaccgctcatgatgcgggatatattaaccagccgctggaaaaa
attgttggcctgcaaacggatgcgccgttgaaacgtgcgctacacccgttcggtggcatt
aatatgattaaaagttcattccacgcctatggccgagaaatggacagtgaatttgaatat
ctgtttaccgatctgcgtaaaacccataaccagggcgtatttgatgtttactcaccggat
atgctgcgctgccgtaaatctggcgtgctgaccggtttaccagatggctatggccgtggg
cgcattatcggtgactatcgccgcgtagcgctgtatggcatcagttatctggtacgtgaa
cgcgaactgcaatttgccgatctccagtctcgtctggaaaaaggcgaggatctggaagcc
accatccgtctgcgtgaggagctggcagagcatcgtcatgcgctgttgcagattcaggaa
atggcggcgaaatatggctttgatatctctcgcccggcgcagaatgcgcaggaagcggtg
cagtggctctacttcgcttatctggcggcagtgaaatcgcaaaatggcggcgcgatgtcg
ctgggccgcacggcatcgttcctcgatatctacattgagcgcgactttaaagctggcgta
ctcaatgagcagcaggcacaggaactgatcgatcacttcatcatgaagatccgtatggta
cgcttcctgcgtacaccggaatttgattcgctgttctccggcgacccaatctgggcgacg
gaagtgatcggcgggatggggctggacggtcgtacgctggtgaccaaaaactccttccgc
tatttgcacaccctgcacactatggggccggcaccggaacctaacctgaccattctttgg
tcggaagaattaccgattgccttcaaaaaatatgccgcgcaggtgtcgatcgtcacctct
tccttgcagtatgaaaatgacgatctgatgcgtactgacttcaacagcgacgattacgcg
attgcctgctgcgtcagcccaatggtgattggtaagcaaatgcagttctttggtgcacgc
gctaacctggcgaaaacgctgctctacgcaattaacggcggggtggacgagaagctgaag
attcaggtcgggccgaaaacagcaccgctgatggacgacgtgctggattacgacaaagtg
atggacagcctcgatcacttcatggactggctggcggtgcagtacatcagcgcgctgaat
atcattcactacatgcacgacaagtacagctacgaagcttcgctgatggcgctgcacgat
cgtgatgtctatcgcactatggcatgcggcatcgcgggcctgtcggtggcgacggactcc
ctgtctgccatcaaatatgcccgcgtgaaaccaatccgtgacgaaaacggcctggcggtg
gactttgaaatcgacggtgaatatccgcagtacggcaacaacgacgagcgcgtagacagc
attgcctgcgacctggttgaacgctttatgaagaaaattaaagcgctgccaacctatcgc
aacgccgtccctacccagtcgattctgactatcacttctaacgtggtgtacggccagaaa
accggtaatacgccggacggtcgtcgcgccggaacaccgttcgcgccgggcgctaacccg
atgcatggtcgtgaccgcaaaggtgccgtggcctcattgacgtcggtggcgaaactgccg
ttcacctacgccaaagatgggatctcgtacaccttctcaatcgttcctgcggcgctgggc
aaagaagatccagtacgtaaaaccaaccttgtcggcctgctggatgggtatttccaccac
gaagcggatgtcgaaggcggtcaacacctcaacgtcaacgtaatgaatcgggaaatgctg
ctggatgccatcgagcacccggaaaaatatcctaccctgacaatccgtgtctctggctac
gccgtgcgcttcaacgcactgacccgtgaacagcaacaggatgttatttcacgtactttt
acccaggcgctctga