Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116008.3.peg.3771 Leucine-specific ABC transporter, substrate-binding protein LivK [Escherichia coli 2735000]
atgaaacggaatgcgaaaactatcatcgcagggatgattgcactggcaatttcacacacc
gctatggctgacgatattaaagtcgccgttgtcggcgcgatgtccggcccgattgcccag
tggggcgatatggaatttaacggcgcgcgtcaggcgattaaagacattaatgccaaaggg
ggaattaagggcgacaagctggttggcgtggaatatgacgacgcctgcgacccgaaacaa
gccgttgcggtcgccaacaaaatcgttaatgacggcattaaatacgttatcggtcatctg
tgttcttcttctacccagcctgcgtcagatatctatgaagacgaaggtattctgatgatc
tcgccgggagcgaccaacccggagctgacccaacgcggttatcaacacattatgcgtact
gccgggctggactcttcccaggggccaacggcggcaaaatacattcttgagacggtgaag
ccccagcgcatcgccatcattcacgacaaacaacaatatggcgaagggctggcacgttcg
gtgcaggacgggctgaaagctgctaacgccaatgtcgttttcttcgacggcattaccgct
ggcgagaaagatttctccgcgctgatcgcccgcctgaaaaaagaaaacatcgacttcgtt
tactacggcggttactacccggaaatggggcagatgctgcgccaggcccgttccgttggc
ctgaaaacccagtttatggggccggaaggtgtgggtaatgcgtcgctgtcgaatattgct
ggcgatgctgccgaaggcatgttggtcaccatgccaaaacgctatgaccaggatccggca
aaccagggcatcgttgatgcgctgaaagcagacaagaaagatccgtccgggccttatgtc
tggatcacctacgcggcggtgcaatctctggcgactgcccttgagcgtactggcagcgat
gagccgctggcgctggtgaaagatttaaaagctaacggtgcaaacaccgtgattgggccg
ctgaactgggatgaaaaaggcgatcttaagggatttgattttggtgtcttccagtggcac
gccgatggttcatccacggcagccaagtga