Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116005.3.peg.62 Acetolactate synthase small subunit (EC 2.2.1.6) [Escherichia coli 2730350]
gtggttaagcaaaacggagagaacctgattatgcgccggatattatcagtcttactcgaa
aatgaatcaggcgcgttatcccgcgtgattggccttttttcccagcgtggctacaacatt
gaaagcctgaccgttgcgccaaccgacgatccgacattatcgcgtatgaccatccagacc
gtgggcgatgaaaaagtgcttgagcagatcgaaaagcaattacacaagctggtcgatgtc
ttgcgcgtgagggagttggggcagggcgcgcatgttgagcgggaaatcatgctggtgaaa
attcaggccagcggttacgggcgtgacgaagtgaaacgtaatacggaaatattccgtggg
caaattatcgatgtcaccccctcgctttataccgttcaattagcaggcaccagcgataag
cttgatgcatttttagcatcgattcgcgatgtggcgaaaattgtggaagttgctcgctct
ggtgtggtcggactttcgcgcggcgataaaataatgcgttga