Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1081887.3.peg.4542 Acetolactate synthase small subunit (EC 2.2.1.6) [Escherichia coli 09BKT078844]
atgcaaaacacaactcatgacaacgtgattctggaactcaccgttcgcaaccatccgggc
gtaatgacccacgtttgtggcctttttgcccgccgcgcttttaacgttgaaggcattctt
tgtctgccgattcaggacagcgacaaaagccatatctggctactggtcaatgacgaccag
cgtctggagcagatgataagccaaatcgataagctggaagatgtggtgaaagtgcagcgt
aatcagtccgatccgacgatgtttaacaagattgcagtgttttttcagtaa